Dataset for CDS BAX-like of Organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6BFP7_BOK-01       atgga-ggtgctgcggcgctcctcgg-tcttcgccgccgagatcatggat
A0A2K6BGU1_BAK1-02      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
A0A2K6BGU1_BAK1-01      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
A0A2K6CI54_BAX-04       atggacgggtccggggagcagcccag----------------aggcgggg
A0A2K6CI54_BAX-02       atggacgggtccggggagcagcccag----------------aggcgggg
A0A2K6CI54_BAX-03       atggacgggtccggggagcagcccag----------------aggcgggg
A0A2K6CI54_BAX-01       atggacgggtccggggagcagcccag----------------aggcgggg
                            * **    * *      * * *                    **  

A0A2K6BFP7_BOK-01       gcctttgaccgctcgcccaccgacaaggagctggtggcccaggcca---a
A0A2K6BGU1_BAK1-02      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
A0A2K6BGU1_BAK1-01      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
A0A2K6CI54_BAX-04       ggcccacca-gctc-t-----------gagcagatcatgaag-----aca
A0A2K6CI54_BAX-02       gtgaggcgg-g----------------aggcagac-----gg-----gcg
A0A2K6CI54_BAX-03       ggcccacca-gctc-t-----------gagcagatcatgaag-----aca
A0A2K6CI54_BAX-01       ggcccacca-gctc-t-----------gagcagatcatgaag-----aca
                                  *                  ** *        *        

A0A2K6BFP7_BOK-01       ggcgct---------------------------------gggccgggagt
A0A2K6BGU1_BAK1-02      ggaggttttccgcagctacgttttttaccgccatcagcaggaacaggagg
A0A2K6BGU1_BAK1-01      ggaggttttccgcagctacgttttttaccgccatcagcaggaacaggagg
A0A2K6CI54_BAX-04       ggggcccttttgcttcagggtttcatccaggatcgagcag-----ggcga
A0A2K6CI54_BAX-02       ggag------------gaggtttcatccaggatcgagcag-----ggcga
A0A2K6CI54_BAX-03       ggggcccttttgcttcagg-------------------------------
A0A2K6CI54_BAX-01       ggggcccttttgcttcagggtttcatccaggatcgagcag-----ggcga
                        ** *                                              

A0A2K6BFP7_BOK-01       acgtgcacgcgcggctactgcgcgccggcctctcctggagcgc---gccc
A0A2K6BGU1_BAK1-02      c--tgaaggggcggctgcc-cctgccgacccagagatggacaccttgccc
A0A2K6BGU1_BAK1-01      c--tgaaggggcggctgcc-cctgccgacccagagatggacaccttgccc
A0A2K6CI54_BAX-04       a--tggggggggagacacc-cgagctggccc-----tggacccggtgcct
A0A2K6CI54_BAX-02       a--tggggggggagacacc-cgagctggccc-----tggacccggtgcct
A0A2K6CI54_BAX-03       --------------------------------------------------
A0A2K6CI54_BAX-01       a--tggggggggagacacc-cgagctggccc-----tggacccggtgcct

A0A2K6BFP7_BOK-01       gagcgcgccgcgcctgtcccgggacgcctggccgaggtgtgcgcggtgct
A0A2K6BGU1_BAK1-02      ctgcaacctagcagcaccatggggc---------aggtgggacggcagct
A0A2K6BGU1_BAK1-01      ctgcaacctagcagcaccatggggc---------aggtgggacggcagct
A0A2K6CI54_BAX-04       cagga---tgcgtccaccaagaggc------------tgagcgagtgtct
A0A2K6CI54_BAX-02       cagga---tgcgtccaccaagaggc------------tgagcgagtgtct
A0A2K6CI54_BAX-03       --------------------------------------------------
A0A2K6CI54_BAX-01       cagga---tgcgtccaccaagaggc------------tgagcgagtgtct

A0A2K6BFP7_BOK-01       tctgcgcctgggggatgagctggaga-------tgatccgg---cccagc
A0A2K6BGU1_BAK1-02      cgccatcatcggggacgacatcaacagacgctatgactcagagttccaga
A0A2K6BGU1_BAK1-01      cgccatcatcggggacgacatcaacagacgctatgactcagagttccaga
A0A2K6CI54_BAX-04       caagcgcatcggggacgaactggacag------taacatggagctgcaga
A0A2K6CI54_BAX-02       caagcgcatcggggacgaactggacag------taacatggagctgcaga
A0A2K6CI54_BAX-03       --------------------------------------------------
A0A2K6CI54_BAX-01       caagcgcatcggggacgaactggacag------taacatggagctgcaga

A0A2K6BFP7_BOK-01       gtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcc
A0A2K6BGU1_BAK1-02      ccatgctgcagcacctgcagcccacggcagagaacgcc----tatgagta
A0A2K6BGU1_BAK1-01      ccatgctgcagcacctgcagcccacggcagagaacgcc----tatgagta
A0A2K6CI54_BAX-04       ggatgat--------tgccgccgtggacacagactccc----cccgag--
A0A2K6CI54_BAX-02       ggatgat--------tgccgccgtggacacagactccc----cccgag--
A0A2K6CI54_BAX-03       ggatgat--------tgccgccgtggacacagactccc----cccgag--
A0A2K6CI54_BAX-01       ggatgat--------tgccgccgtggacacagactccc----cccgag--
                           *               * *     ** *     *        ***  

A0A2K6BFP7_BOK-01       tgtggtgaccgatgcgttcctggccgtggctg--gccacatcttctctgc
A0A2K6BGU1_BAK1-02      cttcaccaagattgcctccaggccagcagcaacacccacagcctgtttga
A0A2K6BGU1_BAK1-01      cttcaccaagattgcctc--------------------cagcctgtttga
A0A2K6CI54_BAX-04       --------aggtctttttccgagtggcagctg-----acatgttttctga
A0A2K6CI54_BAX-02       --------aggtctttttccgagtggcagctg-----acatgttttctga
A0A2K6CI54_BAX-03       --------aggtctttttccgagtggcagctg-----acatgttttctga
A0A2K6CI54_BAX-01       --------aggtctttttccgagtggcagctg-----acatgttttctga
                                        *                     **   * * ** 

A0A2K6BFP7_BOK-01       aggca---tcacgtggggcaaggtggtgtccctgtatgcggtggccgcgg
A0A2K6BGU1_BAK1-02      gagtggcatcaactggggccgtgtggtggctct-----------tctggg
A0A2K6BGU1_BAK1-01      gagtggcatcaactggggccgtgtggtggctct-----------tctggg
A0A2K6CI54_BAX-04       cggcaacttcaactggggccgtgttgtcgccct-----------tttcta
A0A2K6CI54_BAX-02       cggcaacttcaactggggccgtgttgtcgccct-----------tttcta
A0A2K6CI54_BAX-03       cggcaacttcaactggggccgtgttgtcgccct-----------tttcta
A0A2K6CI54_BAX-01       cggcaacttcaactggggccgtgttgtcgccct-----------tttcta
                          *     ***  ******   ** **  * **                 

A0A2K6BFP7_BOK-01       ggctggctgtggactgtgtgaggcaggcccagcctgccatggtccacgct
A0A2K6BGU1_BAK1-02      ctttggctaccgtctg-gccct-----acacgtctacca----gcacggc
A0A2K6BGU1_BAK1-01      ctttggctaccgtctg-gccct-----acacgtctacca----gcacggc
A0A2K6CI54_BAX-04       ctttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcccgaa
A0A2K6CI54_BAX-02       ctttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcccgaa
A0A2K6CI54_BAX-03       ctttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcccgaa
A0A2K6CI54_BAX-01       ctttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcccgaa
                           ** *      *** *          *  *  * ***     * **  

A0A2K6BFP7_BOK-01       ct------------cgtggactgcctgggggagtttgtgcgcaagaccct
A0A2K6BGU1_BAK1-02      ctga----------------------------------------------
A0A2K6BGU1_BAK1-01      ctgactgg---cttcctgggccaggtgacccgcttcgtggtcgacttcat
A0A2K6CI54_BAX-04       ctgatcagaaccatcatgggctggacgctggacttcctccgggagcggct
A0A2K6CI54_BAX-02       ctgatcagaaccatcatgggctggacgctggacttcctccgggagcggct
A0A2K6CI54_BAX-03       ctgatcagaaccatcatgggctggacgctggacttcctccgggagcggct
A0A2K6CI54_BAX-01       ctgatcagaaccatcatgggctggacgctggacttcctccgggagcggct

A0A2K6BFP7_BOK-01       ggca---------------acctggctgcggagacgcggcggatggactg
A0A2K6BGU1_BAK1-02      --------------------------------------------------
A0A2K6BGU1_BAK1-01      gctgcatcactgcattgcccggtggattgcacagaggggtggctgggtgg
A0A2K6CI54_BAX-04       gttg---------------ggctggatccaagaccagggtggttgggtga
A0A2K6CI54_BAX-02       gttg---------------ggctggatccaagaccagggtggttgggacg
A0A2K6CI54_BAX-03       gttg---------------ggctggatccaagaccagggtggttgggacg
A0A2K6CI54_BAX-01       gttg---------------ggctggatccaagaccagggtggttgggacg

A0A2K6BFP7_BOK-01       atgtcctcaagtgtgtggtcagcacagaccctggcctccgctcccactgg
A0A2K6BGU1_BAK1-02      --------------------------------------------------
A0A2K6BGU1_BAK1-01      c-----------------------------------agccctgaacttgg
A0A2K6CI54_BAX-04       gacttctcaa-------------------------ccctcctcaccccaa
A0A2K6CI54_BAX-02       g-----------------------------------cctcctctcctact
A0A2K6CI54_BAX-03       g-----------------------------------cctcctctcctact
A0A2K6CI54_BAX-01       g-----------------------------------cctcctctcctact

A0A2K6BFP7_BOK-01       ctggtagccgcactctgcagcttcggccgcttcctgaaggctg-------
A0A2K6BGU1_BAK1-02      --------------------------------------------------
A0A2K6BGU1_BAK1-01      gcaatggtcccatcctgaacgtgctggtggttctgggt----gtggttct
A0A2K6CI54_BAX-04       ccaccgcccctgccccactgtccctgcccacccccggtcacagtggtgcc
A0A2K6CI54_BAX-02       ttgggacgcccacgtggcagaccgtgacca-tcttggtggctggagtact
A0A2K6CI54_BAX-03       ttgggacgcccacgtggcagaccgtgacca-tcttggtggctggagtact
A0A2K6CI54_BAX-01       ttgggacgcccacgtggcagaccgtgacca-tcttggtggctggagtact

A0A2K6BFP7_BOK-01       --------ccttcttcgtgctgctgccagagagatga-------------
A0A2K6BGU1_BAK1-02      --------------------------------------------------
A0A2K6BGU1_BAK1-01      gttgggccagtttgtggtacgaagattcttcaaatcatga----------
A0A2K6CI54_BAX-04       ctc--tccccatcttcggatcgtcagatgtggtctataatgcatttcctt
A0A2K6CI54_BAX-02       caccgcctccctcaccatctggaagaagatgggctga-------------
A0A2K6CI54_BAX-03       caccgcctccctcaccatctggaagaagatgggctga-------------
A0A2K6CI54_BAX-01       caccgcctccctcaccatctggaagaagatgggctga-------------

A0A2K6BFP7_BOK-01       --------
A0A2K6BGU1_BAK1-02      --------
A0A2K6BGU1_BAK1-01      --------
A0A2K6CI54_BAX-04       atgtgtct
A0A2K6CI54_BAX-02       --------
A0A2K6CI54_BAX-03       --------
A0A2K6CI54_BAX-01       --------

© 1998-2019