Dataset for CDS BAX of Organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6CI54_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K6CI54_BAX-02      atggacgggtccggggagcagcccagaggcgggggtgaggcggg----ag
A0A2K6CI54_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K6CI54_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       ***********************************     *  *      

A0A2K6CI54_BAX-04      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K6CI54_BAX-02      gcagac-----gggcgggag------------gaggtttcatccaggatc
A0A2K6CI54_BAX-03      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A2K6CI54_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
                       *****       * * ** *              *               

A0A2K6CI54_BAX-04      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
A0A2K6CI54_BAX-02      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
A0A2K6CI54_BAX-03      --------------------------------------------------
A0A2K6CI54_BAX-01      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg

A0A2K6CI54_BAX-04      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K6CI54_BAX-02      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K6CI54_BAX-03      --------------------------------------------------
A0A2K6CI54_BAX-01      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg

A0A2K6CI54_BAX-04      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K6CI54_BAX-02      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K6CI54_BAX-03      --------------------------------ggatgattgccgccgtgg
A0A2K6CI54_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg

A0A2K6CI54_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K6CI54_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K6CI54_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K6CI54_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt

A0A2K6CI54_BAX-04      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K6CI54_BAX-02      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K6CI54_BAX-03      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K6CI54_BAX-01      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc

A0A2K6CI54_BAX-04      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K6CI54_BAX-02      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K6CI54_BAX-03      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K6CI54_BAX-01      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca

A0A2K6CI54_BAX-04      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc
A0A2K6CI54_BAX-02      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc
A0A2K6CI54_BAX-03      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc
A0A2K6CI54_BAX-01      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc

A0A2K6CI54_BAX-04      tggatccaagaccagggtggttgggtgagacttctcaaccctcctcaccc
A0A2K6CI54_BAX-02      tggatccaagaccagggtggttgggacgg----------cctcctctcct
A0A2K6CI54_BAX-03      tggatccaagaccagggtggttgggacgg----------cctcctctcct
A0A2K6CI54_BAX-01      tggatccaagaccagggtggttgggacgg----------cctcctctcct
                       *************************   *          ******* ** 

A0A2K6CI54_BAX-04      caaccaccgcccctgccccactgtccctgcccacccccggtcacagtggt
A0A2K6CI54_BAX-02      actttgggacgcccacgtggcagaccgtgacca-tcttggtggctggagt
A0A2K6CI54_BAX-03      actttgggacgcccacgtggcagaccgtgacca-tcttggtggctggagt
A0A2K6CI54_BAX-01      actttgggacgcccacgtggcagaccgtgacca-tcttggtggctggagt
                                * **  *    * * ** ** ***  *  ***  * *  **

A0A2K6CI54_BAX-04      gccctc--tccccatcttcggatcgtcagatgtggtctataatgcatttc
A0A2K6CI54_BAX-02      actcaccgcctccctcaccatctggaagaagatgggctga----------
A0A2K6CI54_BAX-03      actcaccgcctccctcaccatctggaagaagatgggctga----------
A0A2K6CI54_BAX-01      actcaccgcctccctcaccatctggaagaagatgggctga----------
                        * * *   * ** **  *   * *    *  *** **            

A0A2K6CI54_BAX-04      cttatgtgtct
A0A2K6CI54_BAX-02      -----------
A0A2K6CI54_BAX-03      -----------
A0A2K6CI54_BAX-01      -----------

© 1998-2019