Dataset for CDS BAK1 of Organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6BGU1_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K6BGU1_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
                        **************************************************

A0A2K6BGU1_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K6BGU1_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
                        **************************************************

A0A2K6BGU1_BAK1-02      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A2K6BGU1_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
                        **************************************************

A0A2K6BGU1_BAK1-02      ggggcggctgcccctgccgacccagagatggacaccttgcccctgcaacc
A0A2K6BGU1_BAK1-01      ggggcggctgcccctgccgacccagagatggacaccttgcccctgcaacc
                        **************************************************

A0A2K6BGU1_BAK1-02      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
A0A2K6BGU1_BAK1-01      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
                        **************************************************

A0A2K6BGU1_BAK1-02      acatcaacagacgctatgactcagagttccagaccatgctgcagcacctg
A0A2K6BGU1_BAK1-01      acatcaacagacgctatgactcagagttccagaccatgctgcagcacctg
                        **************************************************

A0A2K6BGU1_BAK1-02      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctccag
A0A2K6BGU1_BAK1-01      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctc---
                        ***********************************************   

A0A2K6BGU1_BAK1-02      gccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
A0A2K6BGU1_BAK1-01      -----------------cagcctgtttgagagtggcatcaactggggccg
                                         *********************************

A0A2K6BGU1_BAK1-02      tgtggtggctcttctgggctttggctaccgtctggccctacacgtctacc
A0A2K6BGU1_BAK1-01      tgtggtggctcttctgggctttggctaccgtctggccctacacgtctacc
                        **************************************************

A0A2K6BGU1_BAK1-02      agcacggcctga--------------------------------------
A0A2K6BGU1_BAK1-01      agcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
                        ************                                      

A0A2K6BGU1_BAK1-02      --------------------------------------------------
A0A2K6BGU1_BAK1-01      ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctg
                                                                          

A0A2K6BGU1_BAK1-02      --------------------------------------------------
A0A2K6BGU1_BAK1-01      ggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtgg
                                                                          

A0A2K6BGU1_BAK1-02      --------------------------------------------------
A0A2K6BGU1_BAK1-01      ttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaa
                                                                          

A0A2K6BGU1_BAK1-02      ------
A0A2K6BGU1_BAK1-01      tcatga
                              

© 1998-2018