Dataset for CDS BAX-like of Organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6ZV71_BAX-03           atggacgggtccggggagcagcccag--------aggcggggggcccacc
F6ZV71_BAX-02           atggacgggtccggggagcagcccag--------aggcgggggtgaggcg
F6ZV71_BAX-01           atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A1D5QZS9_BAK1-01      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcaga-
A0A1D5QI80_BAK1-03      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcgga-
A0A1D5QI80_BAK1-01      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcgga-
A0A1D5QI80_BAK1-02      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcgga-
                            * **   * **     ******        **** **         

F6ZV71_BAX-03           agctctgagcagatcatgaagacaggggcccttttgcttcagggtttcat
F6ZV71_BAX-02           gg----aggcagac-----gggcgggag------------gaggtttcat
F6ZV71_BAX-01           agctctgagcagatcatgaagacaggggcccttttgcttcagggtttcat
A0A1D5QZS9_BAK1-01      ------gagcttgccttg-----------ccctctgcttctg--------
A0A1D5QI80_BAK1-03      ------gagcctgccctg-----------ccctctgcttctg--------
A0A1D5QI80_BAK1-01      ------gagcctgccctg-----------ccctctgcttctg--------
A0A1D5QI80_BAK1-02      ------gagcctgccctg-----------ccctctgcttctg--------

F6ZV71_BAX-03           ccaggatcgagcag---ggcgaatggggggggagacacccgagctggccc
F6ZV71_BAX-02           ccaggatcgagcag---ggcgaatggggggggagacacccgagctggccc
F6ZV71_BAX-01           ccaggatcgagcag---ggcgaatggggggggagacacccgagctggccc
A0A1D5QZS9_BAK1-01      --aggagcaggtaacccgggacatggagaag---------------gttt
A0A1D5QI80_BAK1-03      --aggagcaggtagcccgggacacagaggaggttttccgcagctacgttt
A0A1D5QI80_BAK1-01      --aggagcaggtagcccgggacacagaggaggttttccgcagctacgttt
A0A1D5QI80_BAK1-02      --aggagcaggtagcccgggacacagaggaggttttccgcagctacgttt
                          **** *  * *    **   *  * *  *               *   

F6ZV71_BAX-03           tggacccggtgcc-tcaggatgcgtc------------------------
F6ZV71_BAX-02           tggacccggtgcc-tcaggatgcgtc------------------------
F6ZV71_BAX-01           tggacccggtgcc-tcaggatgcgtc------------------------
A0A1D5QZS9_BAK1-01      ttgacc----gccatcagcaagaacagg----------------------
A0A1D5QI80_BAK1-03      tttacc----gccatcagcaggaacaggaggctgaaggggcggctgcccc
A0A1D5QI80_BAK1-01      tttacc----gccatcagcagaaccc------------------------
A0A1D5QI80_BAK1-02      tttacc----gccatca---------------------------------
                        *  ***    *** ***                                 

F6ZV71_BAX-03           ------------------------------------------caccaaga
F6ZV71_BAX-02           ------------------------------------------caccaaga
F6ZV71_BAX-01           ------------------------------------------caccaaga
A0A1D5QZS9_BAK1-01      ---------agagatggtc--------------acctagcagcaccgtgg
A0A1D5QI80_BAK1-03      tgccgacccagagatggacaccttgcccctgcaacctagcagcaccatgg
A0A1D5QI80_BAK1-01      ---------------------------------------ctctgccatga
A0A1D5QI80_BAK1-02      ------------------------------------------caccatgg
                                                                    **  * 

F6ZV71_BAX-03           ggc---------tgagcgagtgtctcaagcgcatcggggacgaactggac
F6ZV71_BAX-02           ggc---------tgagcgagtgtctcaagcgcatcggggacgaactggac
F6ZV71_BAX-01           ggc---------tgagcgagtgtctcaagcgcatcggggacgaactggac
A0A1D5QZS9_BAK1-01      ggca------ggtgggatggcagatc------------------------
A0A1D5QI80_BAK1-03      ggca------ggtgggacggcagctcgccatcatcggggacgacatcaac
A0A1D5QI80_BAK1-01      gccaaggcctggtgggacggcagctcgccatcatcggggacgacatcaac
A0A1D5QI80_BAK1-02      ggca------ggtgggacggcagctcgccatcatcggggacgacatcaac
                        * *         ** *   *    **                        

F6ZV71_BAX-03           ag------taacatggagctgcagaggatgat--------tgccgccgtg
F6ZV71_BAX-02           ag------taacatggagctgcagaggatgat--------tgccgccgtg
F6ZV71_BAX-01           ag------taacatggagctgcagaggatgat--------tgccgccgtg
A0A1D5QZS9_BAK1-01      ------------------------accatgctgcagcacctgcagcccac
A0A1D5QI80_BAK1-03      agacgctatgactcagagttccagaccatgctgcagcacctgcagcccac
A0A1D5QI80_BAK1-01      agacgctatgactcagagttccagaccatgctgcagcacctgcagcccac
A0A1D5QI80_BAK1-02      agacgctatgactcagagttccagaccatgctgcagcacctgcagcccac
                                                *  *** *        *** ***   

F6ZV71_BAX-03           gacacagactccccccgagaggtctttttccgagtggcagc---------
F6ZV71_BAX-02           gacacagactccccccgagaggtctttttccgagtggcagc---------
F6ZV71_BAX-01           gacacagactccccccgagaggtctttttccgagtggcagc---------
A0A1D5QZS9_BAK1-01      agcagaga--acgcctatgagtacttcaccaagatcgcctc---------
A0A1D5QI80_BAK1-03      ggcagaga--acgcctatgagtacttcaccaagattgcctccaggccagc
A0A1D5QI80_BAK1-01      ggcagaga--acgcctatgagtacttcaccaagattgcctc---------
A0A1D5QI80_BAK1-02      ggcagaga--acgcctatgagtacttcaccaagattgcctc---------
                          ** ***   * **   ***  ***   *    * **  *         

F6ZV71_BAX-03           -----------tgacatgttttctgacggcaacttcaactggggccgtgt
F6ZV71_BAX-02           -----------tgacatgttttctgacggcaacttcaactggggccgtgt
F6ZV71_BAX-01           -----------tgacatgttttctgacggcaacttcaactggggccgtgt
A0A1D5QZS9_BAK1-01      -----------cagcctgtt---tgagagtggcatcaaccagggccgtgt
A0A1D5QI80_BAK1-03      agcaacacccacagcctgtt---tgagagtggcatcaactggggccgtgt
A0A1D5QI80_BAK1-01      -----------cagcctgtt---tgagagtggcatcaactggggccgtgt
A0A1D5QI80_BAK1-02      -----------cagcctgtt---tgagagtggcatcaactggggccgtgt
                                      * ****   ***  *   * *****  *********

F6ZV71_BAX-03           tgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgta
F6ZV71_BAX-02           tgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgta
F6ZV71_BAX-01           tgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgta
A0A1D5QZS9_BAK1-01      ggtggctctcctgggcttcggctaccatctggtcct-----acatgtcta
A0A1D5QI80_BAK1-03      ggtggctcttctgggcttcggctaccgtctggccct-----acacgtcta
A0A1D5QI80_BAK1-01      ggtggctcttctgggcttcggctaccgtctggccct-----acacgtcta
A0A1D5QI80_BAK1-02      ggtggctcttctgggcttcggctaccgtctggccct-----acacgtcta
                         ** ** **  *   *** * *  *   ****  **      *  ** **

F6ZV71_BAX-03           ccaaggtgcccgaactgatcagaaccatcatgggctggacgctggacttc
F6ZV71_BAX-02           ccaaggtgcccgaactgatcagaaccatcatgggctggacgctggacttc
F6ZV71_BAX-01           ccaaggtgcccgaactgatcagaaccatcatgggctggacgctggacttc
A0A1D5QZS9_BAK1-01      ccagcgcggcttgactgg-------cttcctgggccaggt----gacccg
A0A1D5QI80_BAK1-03      ccagcacggcctga------------------------------------
A0A1D5QI80_BAK1-01      ccagcacggcctgactgg-------cttcctgggccaggt----gacccg
A0A1D5QI80_BAK1-02      ccagcacggcctgactgg-------cttcctgggccaggt----gacccg
                        ***    * *   *                                    

F6ZV71_BAX-03           ctccgggagcggctgttgggct--------------------ggatccaa
F6ZV71_BAX-02           ctccgggagcggctgttgggct--------------------ggatccaa
F6ZV71_BAX-01           ctccgggagcggctgttgggct--------------------ggatccaa
A0A1D5QZS9_BAK1-01      cttcgtggt---ct-tcatgct----------------------------
A0A1D5QI80_BAK1-03      --------------------------------------------------
A0A1D5QI80_BAK1-01      cttcgtggtcgact-tcatgctgcatcactgcattgcccggtggattgca
A0A1D5QI80_BAK1-02      cttcgtggtcgact-tcatgctgcatcactgcattgcccggtggattgca

F6ZV71_BAX-03           gaccagggtggttgggtgagactcctcaaccctcctcaccccaaccaccg
F6ZV71_BAX-02           gaccagggtggttgggacggcctcctc------tcctactttgg--gacg
F6ZV71_BAX-01           gaccagggtggttgggacggcctcctc------tcctactttgg--gacg
A0A1D5QZS9_BAK1-01      -----gagcagctgggtggcagccctg----------gacttgggcaatg
A0A1D5QI80_BAK1-03      --------------------------------------------------
A0A1D5QI80_BAK1-01      cagaggggtggctgggtggcagccctg----------aacttgggcaatg
A0A1D5QI80_BAK1-02      cagaggggtggctgggtggcagccctg----------aacttgggcaatg

F6ZV71_BAX-03           cccctgccccactgtccctgcccacccccggtcacagtggtgccctctcc
F6ZV71_BAX-02           cccacgtggca--gaccgtgacca-tcttggtggctggagtactcaccgc
F6ZV71_BAX-01           cccacgtggca--gaccgtgacca-tcttggtggctggagtactcaccgc
A0A1D5QZS9_BAK1-01      gtcccatcct---gaacgtgctgg-tgattctgggggtggttctgttggg
A0A1D5QI80_BAK1-03      --------------------------------------------------
A0A1D5QI80_BAK1-01      gtcccatcct---gaacgtgctgg-tggttctgggtgtggttctgttggg
A0A1D5QI80_BAK1-02      gtcccatcct---gaacgtgctgg-tggttctgggtgtggttctgttggg

F6ZV71_BAX-03           ccatcttcggatcgtcagatgtggtctataatgcattt-
F6ZV71_BAX-02           ctccctc---accatc-----tggaagaagatgggctga
F6ZV71_BAX-01           ctccctc---accatc-----tggaagaagatgggctga
A0A1D5QZS9_BAK1-01      cctgtttgtggtacaaggattcttcaaatcatga-----
A0A1D5QI80_BAK1-03      ---------------------------------------
A0A1D5QI80_BAK1-01      ccagtttgtggtacgaagattcttcaaatcatga-----
A0A1D5QI80_BAK1-02      ccagtttgtggtacgaagattcttcaaatcatga-----

© 1998-2019