Dataset for CDS BAX of Organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6ZV71_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatg
F6ZV71_BAX-02      atggacgggtccggggagcagcccagaggcgggggtgaggcggg----aggcagac----
F6ZV71_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatg
                   ***********************************     *  *      *****     

F6ZV71_BAX-03      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggg
F6ZV71_BAX-02      -gggcgggag------------gaggtttcatccaggatcgagcagggcgaatggggggg
F6ZV71_BAX-01      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggg
                     * * ** *              ************************************

F6ZV71_BAX-03      gagacacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaggctgagc
F6ZV71_BAX-02      gagacacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaggctgagc
F6ZV71_BAX-01      gagacacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaggctgagc
                   ************************************************************

F6ZV71_BAX-03      gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
F6ZV71_BAX-02      gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
F6ZV71_BAX-01      gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
                   ************************************************************

F6ZV71_BAX-03      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
F6ZV71_BAX-02      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
F6ZV71_BAX-01      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                   ************************************************************

F6ZV71_BAX-03      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactg
F6ZV71_BAX-02      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactg
F6ZV71_BAX-01      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactg
                   ************************************************************

F6ZV71_BAX-03      gtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacg
F6ZV71_BAX-02      gtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacg
F6ZV71_BAX-01      gtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacg
                   ************************************************************

F6ZV71_BAX-03      ctggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
F6ZV71_BAX-02      ctggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
F6ZV71_BAX-01      ctggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
                   *******************************************************   * 

F6ZV71_BAX-03      ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtccctgcccacccccgg
F6ZV71_BAX-02      ctcctc------tcctactttgg--gacgcccacgtggca--gaccgtgacca-tcttgg
F6ZV71_BAX-01      ctcctc------tcctactttgg--gacgcccacgtggca--gaccgtgacca-tcttgg
                   ******       *  **         *****  *   **  * ** ** ***  *  **

F6ZV71_BAX-03      tcacagtggtgccctctccccatcttcggatcgtcagatgtggtctataatgcattt-
F6ZV71_BAX-02      tggctggagtactcaccgcctccctc---accatc-----tggaagaagatgggctga
F6ZV71_BAX-01      tggctggagtactcaccgcctccctc---accatc-----tggaagaagatgggctga
                   *  * *  ** * * *  **   **    * * **     ***   *  ***   *  

© 1998-2018