Dataset for CDS BAK1 of Organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1D5QZS9_BAK1-01      atggcatcagggcaaggcccagggtttcccaggcaggagtgcagagagct
A0A1D5QI80_BAK1-03      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A1D5QI80_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A1D5QI80_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
                        ***** ** ** ***********   ************ *** ****** 

A0A1D5QZS9_BAK1-01      tgccttgccctctgcttctgaggagcaggtaacccgggacatggagaag-
A0A1D5QI80_BAK1-03      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A1D5QI80_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A1D5QI80_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
                        **** ************************** *********  *** ** 

A0A1D5QZS9_BAK1-01      --------------gtttttgaccgccatcagcaagaacagg--------
A0A1D5QI80_BAK1-03      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A1D5QI80_BAK1-02      ttttccgcagctacgttttttaccgccatca-------------------
A0A1D5QI80_BAK1-01      ttttccgcagctacgttttttaccgccatcagcagaaccc----------
                                      ****** **********                   

A0A1D5QZS9_BAK1-01      -----------------------agagatggtc--------------acc
A0A1D5QI80_BAK1-03      ggggcggctgcccctgccgacccagagatggacaccttgcccctgcaacc
A0A1D5QI80_BAK1-02      --------------------------------------------------
A0A1D5QI80_BAK1-01      --------------------------------------------------
                                                                          

A0A1D5QZS9_BAK1-01      tagcagcaccgtggggca------ggtgggatggcagatc----------
A0A1D5QI80_BAK1-03      tagcagcaccatggggca------ggtgggacggcagctcgccatcatcg
A0A1D5QI80_BAK1-02      ------caccatggggca------ggtgggacggcagctcgccatcatcg
A0A1D5QI80_BAK1-01      ---ctctgccatgagccaaggcctggtgggacggcagctcgccatcatcg
                                ** ** * **      ******* ***** **          

A0A1D5QZS9_BAK1-01      --------------------------------------accatgctgcag
A0A1D5QI80_BAK1-03      gggacgacatcaacagacgctatgactcagagttccagaccatgctgcag
A0A1D5QI80_BAK1-02      gggacgacatcaacagacgctatgactcagagttccagaccatgctgcag
A0A1D5QI80_BAK1-01      gggacgacatcaacagacgctatgactcagagttccagaccatgctgcag
                                                              ************

A0A1D5QZS9_BAK1-01      cacctgcagcccacagcagagaacgcctatgagtacttcaccaagatcgc
A0A1D5QI80_BAK1-03      cacctgcagcccacggcagagaacgcctatgagtacttcaccaagattgc
A0A1D5QI80_BAK1-02      cacctgcagcccacggcagagaacgcctatgagtacttcaccaagattgc
A0A1D5QI80_BAK1-01      cacctgcagcccacggcagagaacgcctatgagtacttcaccaagattgc
                        ************** ******************************** **

A0A1D5QZS9_BAK1-01      ctc--------------------cagcctgtttgagagtggcatcaacca
A0A1D5QI80_BAK1-03      ctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactg
A0A1D5QI80_BAK1-02      ctc--------------------cagcctgtttgagagtggcatcaactg
A0A1D5QI80_BAK1-01      ctc--------------------cagcctgtttgagagtggcatcaactg
                        ***                    *************************  

A0A1D5QZS9_BAK1-01      gggccgtgtggtggctctcctgggcttcggctaccatctggtcctacatg
A0A1D5QI80_BAK1-03      gggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacg
A0A1D5QI80_BAK1-02      gggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacg
A0A1D5QI80_BAK1-01      gggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacg
                        ****************** **************** ***** ****** *

A0A1D5QZS9_BAK1-01      tctaccagcgcggcttgactggcttcctgggccaggtgacccgcttcgtg
A0A1D5QI80_BAK1-03      tctaccagcacggcctga--------------------------------
A0A1D5QI80_BAK1-02      tctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtg
A0A1D5QI80_BAK1-01      tctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtg
                        ********* **** ***                                

A0A1D5QZS9_BAK1-01      gt---cttcatgct---------------------------------gag
A0A1D5QI80_BAK1-03      --------------------------------------------------
A0A1D5QI80_BAK1-02      gtcgacttcatgctgcatcactgcattgcccggtggattgcacagagggg
A0A1D5QI80_BAK1-01      gtcgacttcatgctgcatcactgcattgcccggtggattgcacagagggg
                                                                          

A0A1D5QZS9_BAK1-01      cagctgggtggcagccctggacttgggcaatggtcccatcctgaacgtgc
A0A1D5QI80_BAK1-03      --------------------------------------------------
A0A1D5QI80_BAK1-02      tggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgc
A0A1D5QI80_BAK1-01      tggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgc
                                                                          

A0A1D5QZS9_BAK1-01      tggtgattctgggggtggttctgttgggcctgtttgtggtacaaggattc
A0A1D5QI80_BAK1-03      --------------------------------------------------
A0A1D5QI80_BAK1-02      tggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattc
A0A1D5QI80_BAK1-01      tggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattc
                                                                          

A0A1D5QZS9_BAK1-01      ttcaaatcatga
A0A1D5QI80_BAK1-03      ------------
A0A1D5QI80_BAK1-02      ttcaaatcatga
A0A1D5QI80_BAK1-01      ttcaaatcatga
                                    

© 1998-2018