Dataset for CDS BAX-like of Organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5V7V1_BAX-04       atggacg-ggtccggggagcagcccag--------aggcgggggg-----
A0A2K5V7V1_BAX-03       atggacg-ggtccggggagcagcccag--------aggcgggggt-----
A0A2K5V7V1_BAX-01       atggacg-ggtccggggagcagcccag--------aggcgggggg-----
A0A2K5V7V1_BAX-02       atggacg-ggtccggggagcagcccag--------aggcgggggg-----
A0A2K5X835_BOK-01       atggaggtgctgcggcgc---tcctcggtcttcgccgccgagatcatgga
A0A2K5VC37_BAK1-01      atg-----gcatcagggcaaggcccagggtttcccaggcaggagtgcaga
A0A2K5UMQ3_BAK1-01      atg-----gcttcgggacaaggcccaggtcctcccaggcaggaatgcgga
A0A2K5UMQ3_BAK1-02      atg-----gcttcgggacaaggcccaggtcctcccaggcaggaatgcgga
                        ***     *   * *       **  *         * *  *        

A0A2K5V7V1_BAX-04       ----------------cccaccagctctgagcagatcatgaagac-----
A0A2K5V7V1_BAX-03       ----------------gaggcggg----aggcagac-----gggc-----
A0A2K5V7V1_BAX-01       ----------------cccaccagctctgagcagatcatgaagac-----
A0A2K5V7V1_BAX-02       ----------------cccaccagctctgagcagatcatgaagac-----
A0A2K5X835_BOK-01       tgcctttgaccgctcgcccaccgacaaggagctggtggcccaggcca---
A0A2K5VC37_BAK1-01      gagcttgccttgccc-tctgcttctgaggagcaggtaacccgggacatgg
A0A2K5UMQ3_BAK1-01      gagcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacag
A0A2K5UMQ3_BAK1-02      gagcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacag
                                            *         ** *        *       

A0A2K5V7V1_BAX-04       aggggcccttttgcttcagggt--------------ttcatccaggatcg
A0A2K5V7V1_BAX-03       gggag------------gaggt--------------ttcatccaggatcg
A0A2K5V7V1_BAX-01       aggggcccttttgcttcagg------------------------------
A0A2K5V7V1_BAX-02       aggggcccttttgcttcagggt--------------ttcatccaggatcg
A0A2K5X835_BOK-01       aggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctc
A0A2K5VC37_BAK1-01      agaag---------------gt--------------ttttgaccgccatc
A0A2K5UMQ3_BAK1-01      aggaggttttccgcagctacgt--------------tttttaccgccatc
A0A2K5UMQ3_BAK1-02      aggaggttttccgcagctacgt--------------tttttaccgccatc
                         *  *                                             

A0A2K5V7V1_BAX-04       agcagggcgaatggggggggagacacccgagctggccctggacccggtgc
A0A2K5V7V1_BAX-03       agcagggcgaatggggggggagacacccgagctggccctggacccggtgc
A0A2K5V7V1_BAX-01       --------------------------------------------------
A0A2K5V7V1_BAX-02       agcagggcgaatggggggggagacacccgagctggccctggacccggtgc
A0A2K5X835_BOK-01       tcctggagcgcg---ccggagcgcgccgcgcctgtcccgggacgc----c
A0A2K5VC37_BAK1-01      agcaagaacagg--------------------------------------
A0A2K5UMQ3_BAK1-01      agcaggaacaggaggctgaaggg----gcggctgcccctgccgac----c
A0A2K5UMQ3_BAK1-02      agcaggaacaggaggctgaaggg----gcggctgcccctgccgac----c

A0A2K5V7V1_BAX-04       ctcaggatgcgtcc--------------accaagaggctgagcgagtgtc
A0A2K5V7V1_BAX-03       ctcaggatgcgtcc--------------accaagaggctgagcgagtgtc
A0A2K5V7V1_BAX-01       --------------------------------------------------
A0A2K5V7V1_BAX-02       ctcaggatgcgtcc--------------accaagaggctgagcgagtgtc
A0A2K5X835_BOK-01       tggccgaggtgtgc-------------------gcggt----------gc
A0A2K5VC37_BAK1-01      -a---gagatggtc--------------acctagcagc----------ac
A0A2K5UMQ3_BAK1-01      ca---gagatggacaccttgcccctgcaacctagcagc----------ac
A0A2K5UMQ3_BAK1-02      ca---gagatggacaccttgcccctgcaacctagcagc----------ac

A0A2K5V7V1_BAX-04       tcaagcgcatcggggacg--aactggacagtaacatgga-----------
A0A2K5V7V1_BAX-03       tcaagcgcatcggggacg--aactggacagtaacatgga-----------
A0A2K5V7V1_BAX-01       --------------------------------------------------
A0A2K5V7V1_BAX-02       tcaagcgcatcggggacg--aactggacagtaacatgga-----------
A0A2K5X835_BOK-01       tcctgcgcctgggggatg--agctggagatgatccggcccagcgtc----
A0A2K5VC37_BAK1-01      cgtggggcaggtgggatggcag---------------------atc----
A0A2K5UMQ3_BAK1-01      catggggcaggtgggacggcagctggccatcatcggggacgacatcaaca
A0A2K5UMQ3_BAK1-02      catggggcaggtgggacggcagctggccatcatcggggacgacatcaaca

A0A2K5V7V1_BAX-04       ----------------------------gctgcagaggatgattgccgcc
A0A2K5V7V1_BAX-03       ----------------------------gctgcagaggatgattgccgcc
A0A2K5V7V1_BAX-01       ------------------------------------ggatgattgccgcc
A0A2K5V7V1_BAX-02       ----------------------------gctgcagaggatgattgccgcc
A0A2K5X835_BOK-01       -------taccgcaacgtggctcgtca-gctgca-catctccctgcagtc
A0A2K5VC37_BAK1-01      -----------------------accatgctgcagca----cctgcagcc
A0A2K5UMQ3_BAK1-01      gacgctatgactcagagttccagaccatgctgcagca----cctgcagcc
A0A2K5UMQ3_BAK1-02      gacgctatgactcagagttccagaccatgctgcagca----cctgcagcc
                                                                   *** * *

A0A2K5V7V1_BAX-04       gtggacacagactccccccgagaggtctttttccgagtggcagctga---
A0A2K5V7V1_BAX-03       gtggacacagactccccccgagaggtctttttccgagtggcagctga---
A0A2K5V7V1_BAX-01       gtggacacagactccccccgagaggtctttttccgagtggcagctga---
A0A2K5V7V1_BAX-02       gtggacacagactccccccgagaggtctttttccgagtggcagctga---
A0A2K5X835_BOK-01       tgagcctgtggtgaccgatgcg-----ttcctggccgtggctggcca---
A0A2K5VC37_BAK1-01      cacagcagagaacgcctatgag-----tacttcaccaagatcgcctc---
A0A2K5UMQ3_BAK1-01      cacggcagagaacgcctatgag-----tacttcaccaagattgcctc---
A0A2K5UMQ3_BAK1-02      cacggcagagaacgcctatgag-----tacttcaccaagattgcctccag
                             *   *    **   * *     *   *      *   *       

A0A2K5V7V1_BAX-04       -----------------catgttttctgacggcaacttcaactggggccg
A0A2K5V7V1_BAX-03       -----------------catgttttctgacggcaacttcaactggggccg
A0A2K5V7V1_BAX-01       -----------------catgttttctgacggcaacttcaactggggccg
A0A2K5V7V1_BAX-02       -----------------catgttttctgacggcaacttcaactggggccg
A0A2K5X835_BOK-01       -----------------catcttctctgca---ggcatcacgtggggcaa
A0A2K5VC37_BAK1-01      -----------------cagcctgtttgagagtggcatcaaccagggccg
A0A2K5UMQ3_BAK1-01      -----------------cagcctgtttgagagtggcatcaactggggccg
A0A2K5UMQ3_BAK1-02      gccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
                                         **   * * **       * ***    ****  

A0A2K5V7V1_BAX-04       tgttgtcgccct-------------tttctactttgccagcaaactggtg
A0A2K5V7V1_BAX-03       tgttgtcgccct-------------tttctactttgccagcaaactggtg
A0A2K5V7V1_BAX-01       tgttgtcgccct-------------tttctactttgccagcaaactggtg
A0A2K5V7V1_BAX-02       tgttgtcgccct-------------tttctactttgccagcaaactggtg
A0A2K5X835_BOK-01       ggtggtgtccctgtatgcggtggccgcggggct--ggctgtggactgtgt
A0A2K5VC37_BAK1-01      tgtggtggctct-------------cctgggcttcggctaccatctg---
A0A2K5UMQ3_BAK1-01      tgtggtggctct-------------tctgggcttcggctaccgtctg---
A0A2K5UMQ3_BAK1-02      tgtggtggctct-------------tctgggcttcggctaccgtctg---
                         ** **  * **                   **  * *      ***   

A0A2K5V7V1_BAX-04       ctcaaggccct----gtgtaccaaggtgcccgaactgatcagaaccatca
A0A2K5V7V1_BAX-03       ctcaaggccct----gtgtaccaaggtgcccgaactgatcagaaccatca
A0A2K5V7V1_BAX-01       ctcaaggccct----gtgtaccaaggtgcccgaactgatcagaaccatca
A0A2K5V7V1_BAX-02       ctcaaggccct----gtgtaccaaggtgcccgaactgatcagaaccatca
A0A2K5X835_BOK-01       gaggcaggccca---gcctgccatggtccacgctctcgtgga---ctgcc
A0A2K5VC37_BAK1-01      ------gtcctacatgtctaccag----cgcggcttgactgg---cttcc
A0A2K5UMQ3_BAK1-01      ------gccctacacgtctaccag----cacggcctgactgg---cttcc
A0A2K5UMQ3_BAK1-02      ------gccctacacgtctaccag----cacggcctga------------
                              * **     *  * ***     * **   *              

A0A2K5V7V1_BAX-04       tgggctggacgctggacttcctccggga-----------------gcggc
A0A2K5V7V1_BAX-03       tgggctggacgctggacttcctccggga-----------------gcggc
A0A2K5V7V1_BAX-01       tgggctggacgctggacttcctccggga-----------------gcggc
A0A2K5V7V1_BAX-02       tgggctggacgctggacttcctccggga-----------------gcggc
A0A2K5X835_BOK-01       tgggggagtttgtgcgcaagaccctggcaacctggctgcggagacgcggc
A0A2K5VC37_BAK1-01      tgggccaggtgacccgcttcgt----------------------------
A0A2K5UMQ3_BAK1-01      tgggccaggtgacccgcttcgtggtcgacttcatgctgcatcactgcatt
A0A2K5UMQ3_BAK1-02      --------------------------------------------------

A0A2K5V7V1_BAX-04       tgttgggctggatccaagaccagggtggttgggtgagactcctcaaccct
A0A2K5V7V1_BAX-03       tgttgggctggatccaagaccagggtggttgggacggcctcctc--tcct
A0A2K5V7V1_BAX-01       tgttgggctggatccaagaccagggtggttgggacggcctcctc--tcct
A0A2K5V7V1_BAX-02       tgttgggctggatccaagaccagggtggttgggacggcctcctc--tcct
A0A2K5X835_BOK-01       ggatggactgatgtcctcaagtgtgtggtcagcacagaccctgg--cctc
A0A2K5VC37_BAK1-01      ------------------------------ggtggccgccctgg--act-
A0A2K5UMQ3_BAK1-01      gcccggtggattgcacagaggggtg-gctgggtggcagccctga--act-
A0A2K5UMQ3_BAK1-02      --------------------------------------------------

A0A2K5V7V1_BAX-04       cct------caccccaaccaccgcccctgccccact--gtccctg-----
A0A2K5V7V1_BAX-03       actttgggacgcccacgtggcagaccgtgaccatcttggtggctggagta
A0A2K5V7V1_BAX-01       actttgggacgcccacgtggcagaccgtgaccatcttggtggctggagta
A0A2K5V7V1_BAX-02       actttgggacgcccacgtggcagaccgtgaccatcttggtggctggagta
A0A2K5X835_BOK-01       cgctcccactggctggtagccgcactctgcagcttcggccgcttcctgaa
A0A2K5VC37_BAK1-01      ---------tgggcaatggtcccatcctgaacgtgctggtgatt-ctggg
A0A2K5UMQ3_BAK1-01      ---------tgggcaatggtcccatcctgaacgtgctggtggtt-ctggg
A0A2K5UMQ3_BAK1-02      --------------------------------------------------

A0A2K5V7V1_BAX-04       cccacccccagtcacagtggtgccctctccccatcttcggatcgtcagat
A0A2K5V7V1_BAX-03       ctcaccgc--------------ctccctcaccatct--gga-----agaa
A0A2K5V7V1_BAX-01       ctcaccgc--------------ctccctcaccatct--gga-----agaa
A0A2K5V7V1_BAX-02       ctcaccgc--------------ctccctcaccatct--gga-----agaa
A0A2K5X835_BOK-01       ggctgcct--------------tcttcgtgctgctgccagag----agat
A0A2K5VC37_BAK1-01      ggtggttc--------------tgttgggcctgtttgtggta----caag
A0A2K5UMQ3_BAK1-01      tgtggttc--------------tgttgggccagtttgtggta----cgaa
A0A2K5UMQ3_BAK1-02      --------------------------------------------------

A0A2K5V7V1_BAX-04       g-tggtctataatgcatttccttatgtgtct
A0A2K5V7V1_BAX-03       gatgggctga---------------------
A0A2K5V7V1_BAX-01       gatgggctga---------------------
A0A2K5V7V1_BAX-02       gatgggctga---------------------
A0A2K5X835_BOK-01       ga-----------------------------
A0A2K5VC37_BAK1-01      gattcttcaaatcatga--------------
A0A2K5UMQ3_BAK1-01      gattcttcaaatcatga--------------
A0A2K5UMQ3_BAK1-02      -------------------------------

© 1998-2019