Dataset for CDS BAX of Organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5V7V1_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K5V7V1_BAX-03      atggacgggtccggggagcagcccagaggcgggggtgaggcggg----ag
A0A2K5V7V1_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K5V7V1_BAX-02      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       ***********************************     *  *      

A0A2K5V7V1_BAX-04      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K5V7V1_BAX-03      gcagac-----gggcgggag------------gaggtttcatccaggatc
A0A2K5V7V1_BAX-01      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A2K5V7V1_BAX-02      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
                       *****       * * ** *              *               

A0A2K5V7V1_BAX-04      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
A0A2K5V7V1_BAX-03      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
A0A2K5V7V1_BAX-01      --------------------------------------------------
A0A2K5V7V1_BAX-02      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg

A0A2K5V7V1_BAX-04      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5V7V1_BAX-03      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5V7V1_BAX-01      --------------------------------------------------
A0A2K5V7V1_BAX-02      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg

A0A2K5V7V1_BAX-04      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5V7V1_BAX-03      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5V7V1_BAX-01      --------------------------------ggatgattgccgccgtgg
A0A2K5V7V1_BAX-02      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg

A0A2K5V7V1_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5V7V1_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5V7V1_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5V7V1_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt

A0A2K5V7V1_BAX-04      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5V7V1_BAX-03      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5V7V1_BAX-01      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5V7V1_BAX-02      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc

A0A2K5V7V1_BAX-04      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5V7V1_BAX-03      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5V7V1_BAX-01      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5V7V1_BAX-02      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca

A0A2K5V7V1_BAX-04      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc
A0A2K5V7V1_BAX-03      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc
A0A2K5V7V1_BAX-01      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc
A0A2K5V7V1_BAX-02      gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggc

A0A2K5V7V1_BAX-04      tggatccaagaccagggtggttgggtgagactcctcaaccctcct-----
A0A2K5V7V1_BAX-03      tggatccaagaccagggtggttgggacggcctcctc--tcctactttggg
A0A2K5V7V1_BAX-01      tggatccaagaccagggtggttgggacggcctcctc--tcctactttggg
A0A2K5V7V1_BAX-02      tggatccaagaccagggtggttgggacggcctcctc--tcctactttggg
                       *************************   * ******   *** **     

A0A2K5V7V1_BAX-04      -caccccaaccaccgcccctgccccact--gtccctg-----cccacccc
A0A2K5V7V1_BAX-03      acgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgc
A0A2K5V7V1_BAX-01      acgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgc
A0A2K5V7V1_BAX-02      acgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgc
                        * ***      * * ** ** **  **  **  ***     * **** *

A0A2K5V7V1_BAX-04      cagtcacagtggtgccctctccccatcttcggatcgtcagatg-tggtct
A0A2K5V7V1_BAX-03      --------------ctccctcaccatct--gga-----agaagatgggct
A0A2K5V7V1_BAX-01      --------------ctccctcaccatct--gga-----agaagatgggct
A0A2K5V7V1_BAX-02      --------------ctccctcaccatct--gga-----agaagatgggct
                                     * * *** ******  ***     *** * *** **

A0A2K5V7V1_BAX-04      ataatgcatttccttatgtgtct
A0A2K5V7V1_BAX-03      ga---------------------
A0A2K5V7V1_BAX-01      ga---------------------
A0A2K5V7V1_BAX-02      ga---------------------

© 1998-2019