Dataset for CDS BAK1 of Organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5VC37_BAK1-01      atggcatcagggcaaggcccagggtttcccaggcaggagtgcagagagct
A0A2K5UMQ3_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K5UMQ3_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
                        ***** ** ** ***********   ************ *** ****** 

A0A2K5VC37_BAK1-01      tgccttgccctctgcttctgaggagcaggtaacccgggacatggagaag-
A0A2K5UMQ3_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K5UMQ3_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
                        **** ************************** *********  *** ** 

A0A2K5VC37_BAK1-01      --------------gtttttgaccgccatcagcaagaacagg--------
A0A2K5UMQ3_BAK1-02      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A2K5UMQ3_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
                                      ****** ************* *******        

A0A2K5VC37_BAK1-01      -----------------------agagatggtc--------------acc
A0A2K5UMQ3_BAK1-02      ggggcggctgcccctgccgacccagagatggacaccttgcccctgcaacc
A0A2K5UMQ3_BAK1-01      ggggcggctgcccctgccgacccagagatggacaccttgcccctgcaacc
                                               ******** *              ***

A0A2K5VC37_BAK1-01      tagcagcaccgtggggcaggtgggatggcag-------------------
A0A2K5UMQ3_BAK1-02      tagcagcaccatggggcaggtgggacggcagctggccatcatcggggacg
A0A2K5UMQ3_BAK1-01      tagcagcaccatggggcaggtgggacggcagctggccatcatcggggacg
                        ********** ************** *****                   

A0A2K5VC37_BAK1-01      --atc---------------------------accatgctgcagcacctg
A0A2K5UMQ3_BAK1-02      acatcaacagacgctatgactcagagttccagaccatgctgcagcacctg
A0A2K5UMQ3_BAK1-01      acatcaacagacgctatgactcagagttccagaccatgctgcagcacctg
                          ***                           ******************

A0A2K5VC37_BAK1-01      cagcccacagcagagaacgcctatgagtacttcaccaagatcgcctc---
A0A2K5UMQ3_BAK1-02      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctccag
A0A2K5UMQ3_BAK1-01      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctc---
                        ******** ******************************** *****   

A0A2K5VC37_BAK1-01      -----------------cagcctgtttgagagtggcatcaaccagggccg
A0A2K5UMQ3_BAK1-02      gccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
A0A2K5UMQ3_BAK1-01      -----------------cagcctgtttgagagtggcatcaactggggccg
                                         *************************  ******

A0A2K5VC37_BAK1-01      tgtggtggctctcctgggcttcggctaccatctggtcctacatgtctacc
A0A2K5UMQ3_BAK1-02      tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctacc
A0A2K5UMQ3_BAK1-01      tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctacc
                        ************ **************** ***** ****** *******

A0A2K5VC37_BAK1-01      agcgcggcttgactggcttcctgggccaggtgacccgcttcgt-------
A0A2K5UMQ3_BAK1-02      agcacggcctga--------------------------------------
A0A2K5UMQ3_BAK1-01      agcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
                        *** **** ***                                      

A0A2K5VC37_BAK1-01      --------------------------------------------------
A0A2K5UMQ3_BAK1-02      --------------------------------------------------
A0A2K5UMQ3_BAK1-01      ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctg

A0A2K5VC37_BAK1-01      ggtggccgccctggacttgggcaatggtcccatcctgaacgtgctggtga
A0A2K5UMQ3_BAK1-02      --------------------------------------------------
A0A2K5UMQ3_BAK1-01      ggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtgg

A0A2K5VC37_BAK1-01      ttctgggggtggttctgttgggcctgtttgtggtacaaggattcttcaaa
A0A2K5UMQ3_BAK1-02      --------------------------------------------------
A0A2K5UMQ3_BAK1-01      ttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaa

A0A2K5VC37_BAK1-01      tcatga
A0A2K5UMQ3_BAK1-02      ------
A0A2K5UMQ3_BAK1-01      tcatga

© 1998-2019