Dataset for CDS BOK of Organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3UCC8_BOK-02      atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgc
G3UCC8_BOK-01      atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgc

G3UCC8_BOK-02      tctcccaccgacagagctgttgcccaggccaaggcgctcgggcgtgagttcgtacactcg
G3UCC8_BOK-01      tctcccaccgacagagctgttgcccaggccaaggcgctcgggcgt---ttcgtacactcg
                   *********************************************   ************

G3UCC8_BOK-02      cggctgctgcgcgccggcctggcctggagcgcgccggagcgcgccgcgcccccgggcggc
G3UCC8_BOK-01      cggctgctgcgcgccggcctggcctgg---------------------------------

G3UCC8_BOK-02      cgcctggccgaggtgtgcgccgtactgctgcgcctgggggatgagctggagctgatccgg
G3UCC8_BOK-01      ---ctggccgaggtgtgcgccgtactgctgcgcctgggggatgagctggagctgatccgg

G3UCC8_BOK-02      cccagcgtctaccgcaacgtggcacggcagctgaacctctccctgcagtccgagaccgtg
G3UCC8_BOK-01      cccagcgtctaccgcaacgtggcacggcagctgaacctctccctgcagtccgagaccgtg

G3UCC8_BOK-02      gtgaccgacgcctttctggctgtggccacacagatcttctctgcaggtatctcgtggggg
G3UCC8_BOK-01      gtgaccgacgcctttctggctgtggccacacagatcttctctgcag---------gggca
                   **********************************************         ***  

G3UCC8_BOK-02      aggtgggggtcactgtatgctgtggcttgcgggctggctgtggactgccagcggcagatc
G3UCC8_BOK-01      aggtgggggtcactgtatgctgtggcttgcgggctggctgtggactgccagcggcagatc

G3UCC8_BOK-02      aagcctgtcattcacgccttcgtggactgcctggagaaattcgtgcgcaagatcctggcc
G3UCC8_BOK-01      aagcctgtcattcacgccttcgtggactgcctggagaaattcgtgcgcaagatcctggcc

G3UCC8_BOK-02      ccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtggtcagcacggac
G3UCC8_BOK-01      ccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtggtcagcacggac

G3UCC8_BOK-02      cctggcctccgctcccactggctggtggctgcgttctgcagctttggccgcttcctgaag
G3UCC8_BOK-01      cctggcctccgctcccactggctggtggctgcgttctgcagctttggccgcttcctgaag

G3UCC8_BOK-02      gctgccttcttcatgctgttgccggagaga---
G3UCC8_BOK-01      gctgccttcttcatgctgttgccggagagatga

© 1998-2019