Dataset for CDS BOK of Organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3UCC8_BOK-01      atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgc
G3UCC8_BOK-02      atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgc
                   ************************************************************

G3UCC8_BOK-01      tctcccaccgacagagctgttgcccaggccaaggcgctcgggcgt---ttcgtacactcg
G3UCC8_BOK-02      tctcccaccgacagagctgttgcccaggccaaggcgctcgggcgtgagttcgtacactcg
                   *********************************************   ************

G3UCC8_BOK-01      cggctgctgcgcgccggcctggcctgg---------------------------------
G3UCC8_BOK-02      cggctgctgcgcgccggcctggcctggagcgcgccggagcgcgccgcgcccccgggcggc
                   ***************************                                 

G3UCC8_BOK-01      ---ctggccgaggtgtgcgccgtactgctgcgcctgggggatgagctggagctgatccgg
G3UCC8_BOK-02      cgcctggccgaggtgtgcgccgtactgctgcgcctgggggatgagctggagctgatccgg
                      *********************************************************

G3UCC8_BOK-01      cccagcgtctaccgcaacgtggcacggcagctgaacctctccctgcagtccgagaccgtg
G3UCC8_BOK-02      cccagcgtctaccgcaacgtggcacggcagctgaacctctccctgcagtccgagaccgtg
                   ************************************************************

G3UCC8_BOK-01      gtgaccgacgcctttctggctgtggccacacagatcttctctgcag---------gggca
G3UCC8_BOK-02      gtgaccgacgcctttctggctgtggccacacagatcttctctgcaggtatctcgtggggg
                   **********************************************         ***  

G3UCC8_BOK-01      aggtgggggtcactgtatgctgtggcttgcgggctggctgtggactgccagcggcagatc
G3UCC8_BOK-02      aggtgggggtcactgtatgctgtggcttgcgggctggctgtggactgccagcggcagatc
                   ************************************************************

G3UCC8_BOK-01      aagcctgtcattcacgccttcgtggactgcctggagaaattcgtgcgcaagatcctggcc
G3UCC8_BOK-02      aagcctgtcattcacgccttcgtggactgcctggagaaattcgtgcgcaagatcctggcc
                   ************************************************************

G3UCC8_BOK-01      ccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtggtcagcacggac
G3UCC8_BOK-02      ccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtggtcagcacggac
                   ************************************************************

G3UCC8_BOK-01      cctggcctccgctcccactggctggtggctgcgttctgcagctttggccgcttcctgaag
G3UCC8_BOK-02      cctggcctccgctcccactggctggtggctgcgttctgcagctttggccgcttcctgaag
                   ************************************************************

G3UCC8_BOK-01      gctgccttcttcatgctgttgccggagagatga
G3UCC8_BOK-02      gctgccttcttcatgctgttgccggagaga---
                   ******************************   

© 1998-2018