Dataset for CDS BAX-like of Organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3UCC8_BOK-02       atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgc
G3UCC8_BOK-01       atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgc
G3SNK6_BAK1-01      atggca--tctgggcaaggcccgggtcctcccgggcaggactgtggagactctactccac
G3SQJ6_BAX-01       a---------tggacgggtccggggagcagcc---cagaggcgggggg-----------c
G3SQJ6_BAX-02       a---------tggacgggtccggggagcagcc---cagaggcgggggg-----------c
                    *         **       **  **      *   *        **             *

G3UCC8_BOK-02       tctcccaccgacagagctgttgcccaggc--caaggcgctcgggcgtgagttcgtacact
G3UCC8_BOK-01       tctcccaccgacagagctgttgcccaggc--caaggcgctcgggcgt---ttcgtacact
G3SNK6_BAK1-01      cctccactt-------ctgaggtgcaggtagccagggacgcggaggatgttttccgcagt
G3SQJ6_BAX-01       ccaccaact-------ctga---gcacat---catgaagacgggggcccttttgc---tt
G3SQJ6_BAX-02       ccaccaact-------ctga---gcacat---catgaagacgggggcccttttgc---tt
                     * **           ***     **       * *    ***  *    **       *

G3UCC8_BOK-02       cgcggctgctgc--gcgccggcc--------tggcctggagcgcgccggagcgcgccgcg
G3UCC8_BOK-01       cgcggctgctgc--gcgccggcc--------tggcctgg---------------------
G3SNK6_BAK1-01      tacgtcttttaccgccatcagcaggagcaggaggccgaaggggcggccacacccgctgac
G3SQJ6_BAX-01       cagggtttcatccaggatcgagcaaagcagatgggaggggagacgcctgagctggc---c
G3SQJ6_BAX-02       cagggtttcatccaggatcgagcaaagcagatgggaggggagacgcctgagctggc---c
                       *  *    *      *             **                          

G3UCC8_BOK-02       cccccgggcggccgcctggccgaggtgtgcgccgtactgctgcgcctgggggatgag---
G3UCC8_BOK-01       ---------------ctggccgaggtgtgcgccgtactgctgcgcctgggggatgag---
G3SNK6_BAK1-01      ccggagatggtctccttgcccctg----gagcctaacagtgtcatggggcaggtgggtcg
G3SQJ6_BAX-01       ctggagcggg------tgccccag----gatcc------atccacgaagaagctgagcga
G3SQJ6_BAX-02       ctggagcggg------tgccccag----gatcc------atccacgaagaagctgagcga
                                    ** **  *    *  **         *     *  * ** *   

G3UCC8_BOK-02       ----ctggagctgatccggcccagcgtctaccgcaacg------tggcacggcag---ct
G3UCC8_BOK-01       ----ctggagctgatccggcccagcgtctaccgcaacg------tggcacggcag---ct
G3SNK6_BAK1-01      gcagcttgccatcatcggggatgatatcaaccggcgctacgatgtggagttccagaccat
G3SQJ6_BAX-01       gtgtctcaagcgcatcggggacgaattggacagtaact------tagagctgcagaggat
G3SQJ6_BAX-02       gtgtctcaagcgcatcggggacgaattggacagtaact------tagagctgcagaggat
                        **       *** **       *  ** *   *       * *     ***    *

G3UCC8_BOK-02       gaacctctccctgcagtccgagaccgtgg-----tgaccg--acgcctttctggctgtgg
G3UCC8_BOK-01       gaacctctccctgcagtccgagaccgtgg-----tgaccg--acgcctttctggctgtgg
G3SNK6_BAK1-01      gttgcagcacctgcag-ccaacaccacagaacgcttcccagta---cttcatcaagattg
G3SQJ6_BAX-01       gat--------tgcag-ctgtggacacag-actctccccgtgaagtctttttccgagtgg
G3SQJ6_BAX-02       gat--------tgcag-ctgtggacacag-actctccccgtgaagtctttttccgagtgg
                    *          ***** *      *   *     *  **   *   ***  *     * *

G3UCC8_BOK-02       ccacacagatcttctct----gcaggtatctcgtgggggaggtgggggtcactgtatgct
G3UCC8_BOK-01       ccacacagatcttctct----gcag---------gggcaaggtgggggtcactgtatgct
G3SNK6_BAK1-01      cctcgagcctgttt---gagagcggcatcaactggggccgcgtggtggctctcctaggct
G3SQJ6_BAX-01       cagcagagatgttttccgatggcaacttcaactggggccgggttgttgcccttttctact
G3SQJ6_BAX-02       cagcagagatgttttccgatggcaacttcaactggggccgggttgttgcccttttctact
                    *  *     * **        **           ***    ** *  *      *   **

G3UCC8_BOK-02       gtggcttgcgggctggctgt------------ggactgccagcggc----agatcaagcc
G3UCC8_BOK-01       gtggcttgcgggctggctgt------------ggactgccagcggc----agatcaagcc
G3SNK6_BAK1-01      ttggc-tatcgcctggcctt------------gcacgtctaccagc---atggcctgact
G3SQJ6_BAX-01       ttgcc-agcaaactggtgctcaagaaatatgggaagctcaaggagttgagagaacagata
G3SQJ6_BAX-02       ttgcc-agcaaactggtgctcaag--gtgggcggatgtagaacagtggaaaggagagaga
                     ** *       ****   *            * *     *   *      *        

G3UCC8_BOK-02       ----------------tgtcattcacgccttcgtggactgcctggagaaattcgtgcgca
G3UCC8_BOK-01       ----------------tgtcattcacgccttcgtggactgcctggagaaattcgtgcgca
G3SNK6_BAK1-01      --ggcttcctgggccacgtgaccagcttcgtggcagatttcat------gctgaagcact
G3SQJ6_BAX-01       attaatcatagggtcttgcccccagtgacctctgacttctccttg----gcccctctgct
G3SQJ6_BAX-02       --cagttgtagg---------ccggtgtctgctccttattcattt----attcattcagc
                                                *           * *                 

G3UCC8_BOK-02       agatc--ctggccccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgt
G3UCC8_BOK-01       agatc--ctggccccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgt
G3SNK6_BAK1-01      gcatcgcccgg-----tggattgcacagaggggcggctgggttgcagccct---------
G3SQJ6_BAX-01       acttcttccctgcccctggctgccat-gtggagaagatggcctcctctcct---------
G3SQJ6_BAX-02       aaactttccaag--------gagcac-ctggtagggatggcctcctctcct---------
                           *                     *     * ***  *     ***         

G3UCC8_BOK-02       ggtcagcacggaccctggcctccgctcccactggctggtggctgcgttctgcagctttgg
G3UCC8_BOK-01       ggtcagcacggaccctggcctccgctcccactggctggtggctgcgttctgcagctttgg
G3SNK6_BAK1-01      ---------ggacttaggcaatggtcccatc----cggaatgtgc---tgatagctctgg
G3SQJ6_BAX-01       -----------actttgg----gacccccacgtggcagacagtga---ccatcttcgtgg
G3SQJ6_BAX-02       -----------actttgg----gacccccacgtggcagacagtga---ccatcttcgtgg
                               **   **        **  *      *    **             ***

G3UCC8_BOK-02       ccg-cttcctgaaggctgccttcttcatgctgttgccgga----gaga----
G3UCC8_BOK-01       ccg-cttcctgaaggctgccttcttcatgctgttgccgga----gagatga-
G3SNK6_BAK1-01      ctgtggttctgttgggc-----cagtatgtggtacgaagattctgggatccc
G3SQJ6_BAX-01       ctggcgtgctcactgcctcactcaccatctg----gaagaaaatgggctga-
G3SQJ6_BAX-02       ctggcgtgctcactgcctcactcaccatctg----gaagaaaatgggctga-
                    * *   * **    *       *   **          **    * *     

© 1998-2019