Dataset for CDS BAX of Organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3SQJ6_BAX-02      atggacgggtccggggagcagcccagaggcggggggcccaccaactctgagcacatcatg
G3SQJ6_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccaactctgagcacatcatg
                   ************************************************************

G3SQJ6_BAX-02      aagacgggggcccttttgcttcagggtttcatccaggatcgagcaaagcagatgggaggg
G3SQJ6_BAX-01      aagacgggggcccttttgcttcagggtttcatccaggatcgagcaaagcagatgggaggg
                   ************************************************************

G3SQJ6_BAX-02      gagacgcctgagctggccctggagcgggtgccccaggatccatccacgaagaagctgagc
G3SQJ6_BAX-01      gagacgcctgagctggccctggagcgggtgccccaggatccatccacgaagaagctgagc
                   ************************************************************

G3SQJ6_BAX-02      gagtgtctcaagcgcatcggggacgaattggacagtaacttagagctgcagaggatgatt
G3SQJ6_BAX-01      gagtgtctcaagcgcatcggggacgaattggacagtaacttagagctgcagaggatgatt
                   ************************************************************

G3SQJ6_BAX-02      gcagctgtggacacagactctccccgtgaagtctttttccgagtggcagcagagatgttt
G3SQJ6_BAX-01      gcagctgtggacacagactctccccgtgaagtctttttccgagtggcagcagagatgttt
                   ************************************************************

G3SQJ6_BAX-02      tccgatggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaactg
G3SQJ6_BAX-01      tccgatggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaactg
                   ************************************************************

G3SQJ6_BAX-02      gtgctcaag--gtgggcggatgtagaacagtggaaaggagagaga--cagttgtagg---
G3SQJ6_BAX-01      gtgctcaagaaatatgggaagctcaaggagttgagagaacagataattaatcatagggtc
                   *********   *  * * *  *  *  *** ** ** * *** *   * *  ****   

G3SQJ6_BAX-02      ------ccggtgtctgctccttattcatttattcattcagcaaactttccaag-------
G3SQJ6_BAX-01      ttgcccccagtgacctctgacttctccttggcccctctgctacttcttccctgcccctgg
                         ** *** *  **   *  ** **    * *     *    ****  *       

G3SQJ6_BAX-02      -gagcacctggtagggatggcctcctctcctactttgggacccccacgtggcagacagtg
G3SQJ6_BAX-01      ctgccatgtggagaagatggcctcctctcctactttgggacccccacgtggcagacagtg
                       **  ***    *********************************************

G3SQJ6_BAX-02      accatcttcgtggctggcgtgctcactgcctcactcaccatctggaagaaaatgggctga
G3SQJ6_BAX-01      accatcttcgtggctggcgtgctcactgcctcactcaccatctggaagaaaatgggctga
                   ************************************************************

© 1998-2018