Dataset for CDS BOK of Organism Lepisosteus oculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5MHB6_BOK-01      ctggaggggatggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtg
W5MHB6_BOK-02      ---------atggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtg
                            ***************************************************

W5MHB6_BOK-01      tttgaccgctcccccacggacaaggagctggtctcccaggccaaggcgctctgcagggaa
W5MHB6_BOK-02      tttgaccgctcccccacggacaaggagctggtctcccaggccaaggcgctctgcagggaa
                   ************************************************************

W5MHB6_BOK-01      tacatccactcccggctgaaccgagcgggactaggctggtccaaaccagagcatgcggcc
W5MHB6_BOK-02      tacatccactcccggctgaaccgagcgggactaggctggtccaaaccagagcatgcggcc
                   ************************************************************

W5MHB6_BOK-01      cacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgaccc
W5MHB6_BOK-02      cacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgaccc
                   ************************************************************

W5MHB6_BOK-01      aacatttaccggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtg
W5MHB6_BOK-02      aacatttaccggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtg
                   ************************************************************

W5MHB6_BOK-01      tcagatgccttcctggccgtagctgcagagatcttcagcactgaaattgccaagaaagca
W5MHB6_BOK-02      tcagatgccttcctggccgtagctgcagagatcttcagcactg-----------------
                   *******************************************                 

W5MHB6_BOK-01      gcagtaaaggggaagtgtataacgtgggggaaggtggtatctctgtacgcagtggctgga
W5MHB6_BOK-02      ----------------gtataacgtgggggaaggtggtatctctgtacgcagtggctgga
                                   ********************************************

W5MHB6_BOK-01      ggtctggcggtggactgcgtgcgtcatggacacccagccatggtcgataccattgtggac
W5MHB6_BOK-02      ggtctggcggtggactgcgtgcgtcatggacacccagccatggtcgataccattgtggac
                   ************************************************************

W5MHB6_BOK-01      tgcctgggcgagtttgtgcgcaagagcctggtcgaatggctgaggagaaggggtggatgg
W5MHB6_BOK-02      tgcctgggcgagtttgtgcgcaagagcctggtcgaatggctgaggagaaggggtggatgg
                   ************************************************************

W5MHB6_BOK-01      gctgacgtcacaaagtgtgtagtgaacactgacccccgtctccggtctcactggctaatc
W5MHB6_BOK-02      gctgacgtcacaaagtgtgtagtgaacactgacccccgtctccggtctcactggctaatc
                   ************************************************************

W5MHB6_BOK-01      tctgctgcctgtacctgtggtcacttcgtcaaaaccgtggtcttctaccttctgcgagag
W5MHB6_BOK-02      tctgctgcctgtacctgtggtcacttcgtcaaaaccgtggtcttctaccttctgcgagag
                   ************************************************************

W5MHB6_BOK-01      cgctga
W5MHB6_BOK-02      cgctga
                   ******

© 1998-2018