Dataset for CDS BAX-like of Organism Lepisosteus oculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

W5MCT6_BAX-01       ---------atgg---------------cagattctaccggaagcaaccagggtaacgag
W5N4J7_BAK1-01      ---------atggccacagggggcggagaggaccc--ctggaagccgagtcagaatgaag
W5MHB6_BOK-01       ctggaggggatgg-----aggtgctgcgcaggtct--tcggtgtttgctgctgaagtaat
W5MHB6_BOK-02       ---------atgg-----aggtgctgcgcaggtct--tcggtgtttgctgctgaagtaat
                             ****                 *        **           * *   * 

W5MCT6_BAX-01       atagatga-------------------------aaacggagcagttggtggtgaagata-
W5N4J7_BAK1-01      acagccgtgagagcccgtccccagaaacagtctcagaggagaatgtggtgcaggagacag
W5MHB6_BOK-01       ggaggtgtttgaccgctccccca----------cggacaaggagctggtctcccaggcca
W5MHB6_BOK-02       ggaggtgtttgaccgctccccca----------cggacaaggagctggtctcccaggcca
                      **  *                                ** *  ****     **    

W5MCT6_BAX-01       -------ctgttgatgatgtaatcatt-------gaacaaggagctgttgtttttcgagg
W5N4J7_BAK1-01      aggaggtcttctgcagctacgtctactaccggtacaaccaggag-----------cggga
W5MHB6_BOK-01       aggcgctctgcagggaatacatccactcccggctgaacc--gag-----------cggga
W5MHB6_BOK-02       aggcgctctgcagggaatacatccactcccggctgaacc--gag-----------cggga
                           **   *    *      * *        ***   ***           ** * 

W5MCT6_BAX-01       atatgttgt-----------agaggcagctcgtgtggataaccaagaatttgtcattgct
W5N4J7_BAK1-01      gcaggatgg---------agacaagctgcccagg-----gaccctgagat------catg
W5MHB6_BOK-01       ctaggctggtccaaaccagagcatgcggcccacg-----gg----gaggtgtcctccgtc
W5MHB6_BOK-02       ctaggctggtccaaaccagagcatgcggcccacg-----gg----gaggtgtcctccgtc
                      * * **              * ** ** *  *           **  *          

W5MCT6_BAX-01       ccggaggatttaggagg----gagaccaaatgaaggacaggacagtcaagtgaaagacat
W5N4J7_BAK1-01      gcactgcacctcaacagcaccagcaccatgtctcgagttgg-gcagcagctggccatcat
W5MHB6_BOK-01       ctgctgtggctcggcga----------------tgagctggaatacctgcgacccaacat
W5MHB6_BOK-02       ctgctgtggctcggcga----------------tgagctggaatacctgcgacccaacat
                         *    *                       *    **     *          ***

W5MCT6_BAX-01       tgtaagaaatttaattgaaatagctga---------------tgagctgaatagaaatgc
W5N4J7_BAK1-01      -----------tggcgatgaca--tcaacaggcgctatgacctcagctttactagcatgc
W5MHB6_BOK-01       ttaccggaatgtggcga-gacaactcagca-tcactgtggcctcgg-------agaacat
W5MHB6_BOK-02       ttaccggaatgtggcga-gacaactcagca-tcactgtggcctcgg-------agaacat
                               *       * *  * *               *  *          *   

W5MCT6_BAX-01       tgaactggaaagtcttctcagcagggttgagtttgactcggcagagagtttgtttttcac
W5N4J7_BAK1-01      tgtcccatctggccctcacgcccg---------agaat--gcctacaactacttctgcaa
W5MHB6_BOK-01       tgtgtcagat-gccttcctggccg---------tagct--gcagagatcttcagcactga
W5MHB6_BOK-02       tgtgtcagat-gccttcctggccg---------tagct--gcagagatcttcagcactg-
                    **         * * **    * *             *  **  * *  *          

W5MCT6_BAX-01       tgtggcaaggaagatttttgaagacg------gtattaactggggacgagtggtggctct
W5N4J7_BAK1-01      gattgccaagagcctgtttgactctg------gaataaactggggtcgtgtgatcgccct
W5MHB6_BOK-01       aattgccaagaaagcagcagtaaaggggaagtgtataacgtgggggaaggtggtatctct
W5MHB6_BOK-02       --------------------------------gtataacgtgggggaaggtggtatctct
                                                    * ** *  *****    *** *  * **

W5MCT6_BAX-01       ttttcacttggcttacaaacttataatcaaggcaatcacaagaga------ccgcaatga
W5N4J7_BAK1-01      gctgagcttcgggtaccgcatggcactgcacgt-cttccagcagg------gcatgacgg
W5MHB6_BOK-01       ------------gtacgcagtgg--ctggaggt-ctggcggtggactgcgtgcgtcatgg
W5MHB6_BOK-02       ------------gtacgcagtgg--ctggaggt-ctggcggtggactgcgtgcgtcatgg
                                 ***    *     *  * *   *  *    *        *   * * 

W5MCT6_BAX-01       gattattcaaacg-----------atcattggctgggtattaaatttcattggagaacac
W5N4J7_BAK1-01      gcttcctgagccg----------catcgcccgcttcatcagcgactttctgctgcggcac
W5MHB6_BOK-01       acaccc--agccatggtcgataccattgtggactgcctgggcgagtttgtgcgcaagagc
W5MHB6_BOK-02       acaccc--agccatggtcgataccattgtggactgcctgggcgagtttgtgcgcaagagc
                            *  *            **      **   *     * **  *         *

W5MCT6_BAX-01       ---gtttcacgctggatcagagagcatggaggatgggagggtgtccggaattattcccag
W5N4J7_BAK1-01      cagatcgctcagtggatcgcacagcaaggaggctgggtggctg-----------------
W5MHB6_BOK-01       ctggtcg---aatggct--------gaggagaaggggtggatg-----------------
W5MHB6_BOK-02       ctggtcg---aatggct--------gaggagaaggggtggatg-----------------
                        *       *** *          ****   *** ** **                 

W5MCT6_BAX-01       aatctgaggtggcagaatgt--------------------------ggctatatttg---
W5N4J7_BAK1-01      -cgctggagctggacaatgtctatgtgaa-----------------gtacatgctgg---
W5MHB6_BOK-01       -ggctgacgtcacaaagtgtgta-gtgaacactgacccccgtctccggtctcactggcta
W5MHB6_BOK-02       -ggctgacgtcacaaagtgtgta-gtgaacactgacccccgtctccggtctcactggcta
                       ***  *    * * ***                          *       * *   

W5MCT6_BAX-01       ----ctgctg-cagt----tctcacaggtgtcttggcatactggaagatgtccag-----
W5N4J7_BAK1-01      --ctctgctggcagtcatcctccttggtcagttcatc--gtccgacgattcttcagctc-
W5MHB6_BOK-01       atctctgctgcctgt----acctgtggtcacttcgtcaaaaccg-tggtcttctaccttc
W5MHB6_BOK-02       atctctgctgcctgt----acctgtggtcacttcgtcaaaaccg-tggtcttctaccttc
                        ****** * **           *     *   *      *  * *           

W5MCT6_BAX-01       ----------ctga
W5N4J7_BAK1-01      ----------ctga
W5MHB6_BOK-01       tgcgagagcgctga
W5MHB6_BOK-02       tgcgagagcgctga

© 1998-2019