Dataset for CDS BAX of Organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H3ABM8_BAX-01      atggcggatgagtgcggttgtgaggatagtcttggcagcgcggaggctgcctgggccgcg
H3ASQ4_BAX-01      atggca---------------------actcccgttaaaacggagg-ggtccggaaaaga
                   *****                      * **  *  *   ******  * * **      

H3ABM8_BAX-01      ggagacagcagtccccgggctcagatggggagaaggacgcctgctagcaacgcagataat
H3ASQ4_BAX-01      gaagaaagaaaacc---------aaggtggtgctggaggc--actggagacgcagcagat
                   * *** ** *  **          * * ** *  *** **   ** *  ******   **

H3ABM8_BAX-01      gctacggagcagatcttacagacaggacaggtgttattaaaagggttcatcttggaccga
H3ASQ4_BAX-01      g---agcagctaaagcagcaagcaggaaacgtcttac---gtggatttatagtacagttg
                   *    * ***  *     **  ***** * ** ***      ** ** **  *  *    

H3ABM8_BAX-01      atccagcgtggtgtcgaaacacggtgcgtgcaagtgactccagaccagctgggagtgacg
H3ASQ4_BAX-01      actcataatgatgaccaa-----------gaaatccatctcaggccagaggaccttggtg
                   *  **   ** ** * **           * **   *   *** ****  *    **  *

H3ABM8_BAX-01      g-----aggagcagctgagcaatcccagcttcaagaacttggcgaactgtctgagacaaa
H3ASQ4_BAX-01      gctctcagaacgatatagaaaacccaaagacaaaggagattgttaacaatttaattaaaa
                   *     ** *  *  *    ** ** *     *** *  * *  ***  * * *   ***

H3ABM8_BAX-01      ttggggatgagctggatgggaaccaggtgctccaaagagagatcagccgagtgaagactg
H3ASQ4_BAX-01      ttggagatgagcttaataagaatgttgaattgcagaggatgattgaaaatgttcccattg
                   **** ********  **  ***    *   * ** **   ***       **    * **

H3ABM8_BAX-01      actcctcgaaagaagtcttctttcaggtggtgagagaggtgttctctgatgggaagttca
H3ASQ4_BAX-01      ggtctgctcaggaagtgttttttcaagtagcacaaagcctatttgctgggggca---tta
                     **  *  * ***** ** ***** ** *    *    * **  ***  ** *   * *

H3ABM8_BAX-01      actggggccgcgtggtggcactcttctacttcgcctgcaagctgatcatcagggctttat
H3ASQ4_BAX-01      actggggaaggatcgttgcccttttctactttacctccaaacttgtacttaaggcaataa
                   *******  *  * ** ** ** ********  *** *** **  *  * * ***  ** 

H3ABM8_BAX-01      gcgaaaacattcccaagatagtgcggaccatcattgagtggaccatggaatacctgcggg
H3ASQ4_BAX-01      caaccaaccttagagaaataataacaaccatagtcaactggacattggatttcattgtac
                        *** **    * *** *    *****  *  * *****  **** * * *     

H3ABM8_BAX-01      atcatgttgtccagtggatccgggaacaaggaggatggga---------cagcatctgct
H3ASQ4_BAX-01      aaaatgtaatacggtgggttcgtgaacaaggaggatgggaaaatgttcgcaataacttct
                   *  ****  * * **** * ** *****************         **  * ** **

H3ABM8_BAX-01      tgtacgtgaagagacacaat-taccat--gtgacaatgatttttctcaccggctttttgg
H3ASQ4_BAX-01      actctatgaactggcagaatgtggcgttctttgcagcgggagtccttaccggagttttgg
                     *   ****  * ** *** *  * *   *  **  *    * ** *****  ******

H3ABM8_BAX-01      ctgcttttcttgtcatgcggttctcctag
H3ASQ4_BAX-01      c----tttctggaaa-----ctgacttaa
                   *    ***** *  *      *  * ** 

© 1998-2018