Dataset for CDS BAX-like of Organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3N6F3_BOK-01           ------------------ctgcct--------------------------
I3MM08_BAX-01           atggacgggtccggggagcagccca------------gagga----ggcg
I3MM08_BAX-02           atggacgggtccggggagcagccca------------gagga----ggcg
A0A287D718_BAK1-01      atggc---atccgggcaa-ggcccaggtcctcccagtgaggaatgtggag
A0A287D718_BAK1-02      atggc---atccgggcaa-ggcccaggtcctcccagtgaggaatgtggag
                                            ***                           

I3N6F3_BOK-01           ------cttccag--ctgggctgagggccactccaggaca----------
I3MM08_BAX-01           ggc---ccaccagctctgagcag------a-tcatgaagacaggggccct
I3MM08_BAX-02           ggc---ccaccagctctgagcag------a-tcatgaagacaggggccct
A0A287D718_BAK1-01      agccagcctccgattctgagcagcaggtag-tccaggacacggaggaggt
A0A287D718_BAK1-02      agccagcctccgattctgagcagcaggtag-tccaggacacggaggaggt
                              *  **    *** ** *        **  * * *          

I3N6F3_BOK-01           -ttcctt-------------------------------------------
I3MM08_BAX-01           tttgctt---cagggtttcatccaggatcgagcaggtcggatgggggggg
I3MM08_BAX-02           tttgctt---cagg------------------------------------
A0A287D718_BAK1-01      ttttcgtagctacgtttattaccgtcaccggcaggagcaggaggctgagg
A0A287D718_BAK1-02      ttttcgtagctacgtttattaccgtcaccggcaggagcaggaggctgagg
                         ** * *                                           

I3N6F3_BOK-01           -----------------------------gtcct-----------cccca
I3MM08_BAX-01           acaca---------------tcagagctggccttggagcaggtgccccag
I3MM08_BAX-02           --------------------------------------------------
A0A287D718_BAK1-01      gagcagctgcccctgctgacccagagatggtcttgg---------cccta
A0A287D718_BAK1-02      gagcagctgcccctgctgacccagagatggtcttgg---------cccta
                                                                          

I3N6F3_BOK-01           gagcctgccagccctctgggacgtgctgacctcttgtgtgcctatgcagg
I3MM08_BAX-01           gatgcttccaccaagaagctgagcgagtgtctgaagcgc------atcgg
I3MM08_BAX-02           --------------------------------------------------
A0A287D718_BAK1-01      gaacctaccagtaccatggggcaggtgggtcggcagctcgctgtgattgg
A0A287D718_BAK1-02      gaacctaccagtaccatggggcaggtgggtcggcagctcgctgtgattgg
                                                                          

I3N6F3_BOK-01           ggatgagctggagcagatccggcccagtgtgtaccgcaatgtggccggcc
I3MM08_BAX-01           tgatgaactagacag------taacatggagcttcagaggatgattg---
I3MM08_BAX-02           --------------------------------------ggatgattg---
A0A287D718_BAK1-01      tgacgacatcaaccggcgctacgactctgagttccagagcatgcttgaac
A0A287D718_BAK1-02      tgacgacatcaaccggcgctacgactctgagttccagagcatgcttgaac
                                                                 **   *   

I3N6F3_BOK-01           agctgcacctctccg-tgcagtcg-----gagcccgtggtgacagatgca
I3MM08_BAX-01           ------------cagctgtggacac----agactccccccgagaggtctt
I3MM08_BAX-02           ------------cagctgtggacac----agactccccccgagaggtctt
A0A287D718_BAK1-01      aactgcaacctacagctgcgaatgcctatgaactcttcacca-agatcgc
A0A287D718_BAK1-02      aactgcaacctacagctgcgaatgcctatgaactcttcacca-agatcgc
                                    * * **              * *      * ** *   

I3N6F3_BOK-01           ttcctggctgtggcagg--------ccacatcttctctgcaggca---tc
I3MM08_BAX-01           tttccga--gtggcagc--------tgacatgtttgctgacggcaacttc
I3MM08_BAX-02           tttccga--gtggcagc--------tgacatgtttgctgacggcaacttc
A0A287D718_BAK1-01      ctc----------------------cagcctgtttgagagtggca---tc
A0A287D718_BAK1-02      ctccagg--ccagcagcaacacccacagcctgtttgagagtggca---tc
                         *                          * * **       ****   **

I3N6F3_BOK-01           acgtggggcaaagtggt-gtccctgtacgcagtggctgcaggactggctg
I3MM08_BAX-01           aactggggccgggttgtcgcccttttctactttgccagca-aactggtgc
I3MM08_BAX-02           aactggggccgggttgtcgcccttttctactttgccagca-aactggtgc
A0A287D718_BAK1-01      aactggggccgtgtggtggctctcctgggctttggctatc-gcctggcct
A0A287D718_BAK1-02      aactggggccgtgtggtggctctcctgggctttggctatc-gcctggcct
                        *  ******   ** ** *  *   *   *  ** *       ****   

I3N6F3_BOK-01           tggactgtgtgcggcaggcccagcccgccatggtccacgccctggtggac
I3MM08_BAX-01           tcaaggccctgtgtaccaaggtgccagagctgatcagaaccatcatgggc
I3MM08_BAX-02           tcaag---------------------------------------------
A0A287D718_BAK1-01      tacacgtctaccggcatggcctgacaggcttcctgggccaggtgacccac
A0A287D718_BAK1-02      tacacgtctaccggcatggcctga--------------------------
                        *  *                                              

I3N6F3_BOK-01           tgcctgggggagtttgtgcgcaagaccctggcagcctggctgaggcggcg
I3MM08_BAX-01           tggacgctggacttcctccgagagcggctactgggctggattcaagatca
I3MM08_BAX-02           --------------------------------------------------
A0A287D718_BAK1-01      tttgtggtcgacttcatgttgcatcgctgcattgcccggtggatcgcaca
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

I3N6F3_BOK-01           tggtggatggactgatgtcctcagatgcgtggtcagcacggaccctggcc
I3MM08_BAX-01           gggtggttgg---------------gatggcctcctctcctactttggga
I3MM08_BAX-02           --------------------------------------------------
A0A287D718_BAK1-01      gagaggaggc---------------tgggtggccgccctggacttgggca
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

I3N6F3_BOK-01           tccgtgcacactggctggtggctgcgctctgcagttttggccgcttcctg
I3MM08_BAX-01           cccccacgtggcagacagtgaccatctt------tgtggccggagtgctc
I3MM08_BAX-02           --------------------------------------------------
A0A287D718_BAK1-01      acggcccaatccggaatgtgctggtggt------tctggctgtggttctg
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

I3N6F3_BOK-01           aaggctgcctttttcatgctgctgccggagagatga---
I3MM08_BAX-01           accgcctctctcaccatctggaagaagatgggttga---
I3MM08_BAX-02           ---------------------------------------
A0A287D718_BAK1-01      ctgggccagtttgtggtacgaagattcttcaagtcatga
A0A287D718_BAK1-02      ---------------------------------------
                                                               

© 1998-2018