Dataset for CDS BAX of Organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3MM08_BAX-01      atggacgggtccggggagcagcccagaggaggcgggcccaccagctctgagcagatcatg
I3MM08_BAX-02      atggacgggtccggggagcagcccagaggaggcgggcccaccagctctgagcagatcatg
                   ************************************************************

I3MM08_BAX-01      aagacaggggcccttttgcttcagggtttcatccaggatcgagcaggtcggatggggggg
I3MM08_BAX-02      aagacaggggcccttttgcttcagg-----------------------------------
                   *************************                                   

I3MM08_BAX-01      gacacatcagagctggccttggagcaggtgccccaggatgcttccaccaagaagctgagc
I3MM08_BAX-02      ------------------------------------------------------------
                                                                               

I3MM08_BAX-01      gagtgtctgaagcgcatcggtgatgaactagacagtaacatggagcttcagaggatgatt
I3MM08_BAX-02      ----------------------------------------------------ggatgatt
                                                                       ********

I3MM08_BAX-01      gcagctgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
I3MM08_BAX-02      gcagctgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                   ************************************************************

I3MM08_BAX-01      gctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
I3MM08_BAX-02      gctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
                   ************************************************************

I3MM08_BAX-01      gtgctcaaggccctgtgtaccaaggtgccagagctgatcagaaccatcatgggctggacg
I3MM08_BAX-02      gtgctcaag---------------------------------------------------
                   *********                                                   

I3MM08_BAX-01      ctggacttcctccgagagcggctactgggctggattcaagatcagggtggttgggatggc
I3MM08_BAX-02      ------------------------------------------------------------
                                                                               

I3MM08_BAX-01      ctcctctcctactttgggacccccacgtggcagacagtgaccatctttgtggccggagtg
I3MM08_BAX-02      ------------------------------------------------------------
                                                                               

I3MM08_BAX-01      ctcaccgcctctctcaccatctggaagaagatgggttga
I3MM08_BAX-02      ---------------------------------------
                                                          

© 1998-2018