Dataset for CDS BAK1 of Organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287D718_BAK1-01      atggcatccgggcaaggcccaggtcctcccagtgaggaatgtggagagcc
A0A287D718_BAK1-02      atggcatccgggcaaggcccaggtcctcccagtgaggaatgtggagagcc
                        **************************************************

A0A287D718_BAK1-01      agcctccgattctgagcagcaggtagtccaggacacggaggaggtttttc
A0A287D718_BAK1-02      agcctccgattctgagcagcaggtagtccaggacacggaggaggtttttc
                        **************************************************

A0A287D718_BAK1-01      gtagctacgtttattaccgtcaccggcaggagcaggaggctgagggagca
A0A287D718_BAK1-02      gtagctacgtttattaccgtcaccggcaggagcaggaggctgagggagca
                        **************************************************

A0A287D718_BAK1-01      gctgcccctgctgacccagagatggtcttggccctagaacctaccagtac
A0A287D718_BAK1-02      gctgcccctgctgacccagagatggtcttggccctagaacctaccagtac
                        **************************************************

A0A287D718_BAK1-01      catggggcaggtgggtcggcagctcgctgtgattggtgacgacatcaacc
A0A287D718_BAK1-02      catggggcaggtgggtcggcagctcgctgtgattggtgacgacatcaacc
                        **************************************************

A0A287D718_BAK1-01      ggcgctacgactctgagttccagagcatgcttgaacaactgcaacctaca
A0A287D718_BAK1-02      ggcgctacgactctgagttccagagcatgcttgaacaactgcaacctaca
                        **************************************************

A0A287D718_BAK1-01      gctgcgaatgcctatgaactcttcaccaagatcgcctc------------
A0A287D718_BAK1-02      gctgcgaatgcctatgaactcttcaccaagatcgcctccaggccagcagc
                        **************************************            

A0A287D718_BAK1-01      --------cagcctgtttgagagtggcatcaactggggccgtgtggtggc
A0A287D718_BAK1-02      aacacccacagcctgtttgagagtggcatcaactggggccgtgtggtggc
                                ******************************************

A0A287D718_BAK1-01      tctcctgggctttggctatcgcctggccttacacgtctaccggcatggcc
A0A287D718_BAK1-02      tctcctgggctttggctatcgcctggccttacacgtctaccggcatggcc
                        **************************************************

A0A287D718_BAK1-01      tgacaggcttcctgggccaggtgacccactttgtggtcgacttcatgttg
A0A287D718_BAK1-02      tga-----------------------------------------------
                        ***                                               

A0A287D718_BAK1-01      catcgctgcattgcccggtggatcgcacagagaggaggctgggtggccgc
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

A0A287D718_BAK1-01      cctggacttgggcaacggcccaatccggaatgtgctggtggttctggctg
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

A0A287D718_BAK1-01      tggttctgctgggccagtttgtggtacgaagattcttcaagtcatga
A0A287D718_BAK1-02      -----------------------------------------------
                                                                       

© 1998-2018