Dataset for CDS BAK1 of Organism Hydra vulgaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A1E3K5_BAK1-01      atggcagaa-------gcagctgatgatcttcataagcaagaagaacaacaagtagctaa
A7LM76_BAK1-01      atggctgaacatgaatgcaa-tggtagctctgatgacttag------ttcagttaactaa
                    ***** ***       ***  ** *     * ** *   **        **  ** ****

A1E3K5_BAK1-01      tgatacagaaaaagttttttgcagctttgtcta-caaacgtttaactagtgaaatcgaca
A7LM76_BAK1-01      aacagctgaaaacatagtacggtgttttatatatcgaatg-----ctagaaaaagttata
                         * *****  *  *  *  * *** * ** * ** *     ****  ***   * *

A1E3K5_BAK1-01      aa-gagtcctcagacg--gcagtcttgaagttggcaatgtcattact-----aaccta--
A7LM76_BAK1-01      aataaatcctcttgtgaagaaaactttcgattgcatttttctttacttcctgaacctgtt
                    **  * *****    *  * *  ***    ***    * ** *****     *****   

A1E3K5_BAK1-01      cgtagtgaagtaacagaatttaga-aatgtt--------gatgagagtaatggagaaaca
A7LM76_BAK1-01      ctttgtgagataagagctgttaaagaatatctgcgtaaatgtgaaagttcttactcaact
                    * * ****  *** **   *** * *** *           *** ***  *     *** 

A1E3K5_BAK1-01      gaaaatcttggtagagtcttagctt----------cattt------------------gg
A7LM76_BAK1-01      gaaaa-------agattcctggtttatacacaaggcagttcaaattcttgaggagcaagg
                    *****       *** ** * * **          ** **                  **

A1E3K5_BAK1-01      tgatgaaataaatgataaatacagacaagtgttttcagatatgttatgtcgcttgaacat
A7LM76_BAK1-01      tggcatagcaattcaaaaatatcatcatgcgtttcttagtttaattaatcagttacaaat
                    **    *  ** * * *****    ** * ****     * *  *   **  **  * **

A1E3K5_BAK1-01      tgaaacagaag------atgttgcttatgagacttttgctaacattgcaagacgtctttt
A7LM76_BAK1-01      ---aacagatgaatataattttgcttatactcagtttgttgaagttgctaaaaaactttt
                       ****** *      ** ********      **** * *  **** * *   *****

A1E3K5_BAK1-01      tgaaaatg---gtattaattgggggcgtattgtagctcttttgtgttttggctatgaagt
A7LM76_BAK1-01      tgagaatgacaacattgcatggagtcatattgtttccttgatatgttttggtgtagaaat
                    *** ****     ***   *** * * ******  *  *  * ********    *** *

A1E3K5_BAK1-01      tgcatttgcaattattaagcgaaatgcgcgtgggtttggaaaatttttgcgcaaattgat
A7LM76_BAK1-01      ttctgtttacatagtcgagcatggcaaagtagggcttgcatcatttttaaaaaagatatg
                    * *  **   **  *  ***           *** *** *  ******    **  *   

A1E3K5_BAK1-01      tcgttttgtggttgattttattgtgaatgaaaagatagcaaagtggattgccaaaaacgg
A7LM76_BAK1-01      cagttttattgtggactttattgtaaaagaagaaattttgcagtggattgcacaacatgg
                      ***** * ** ** ******** ** *** * **     **********  ** * **

A1E3K5_BAK1-01      aggttg---------gctggctgctcttgttggtttaaa---------------------
A7LM76_BAK1-01      tggatggattaaaatgattgatttttttgatgatccaaactgtcagtttcgtactaatca
                     ** **         * * * *  * *** ** *  ***                     

A1E3K5_BAK1-01      ---------------gaaagtagatga------cagttctgatgtatggtttaaaag---
A7LM76_BAK1-01      tatcttggccgctatggcaatatctgaactaactaatattgaagtatggcttcaacgttt
                                   *  * **  ***       * *  *** ****** ** ** *   

A1E3K5_BAK1-01      aatcgtgattcta--ggatctagcaa----tgctacagtttatatgatacaccgtagaac
A7LM76_BAK1-01      ttttgtggcttcactggtttcaggaataattgttattgcttggagaaaatggcatcaacc
                      * ***  *  *  ** *  ** **    ** **  * **  *  * *   * *  * *

A1E3K5_BAK1-01      acgttag
A7LM76_BAK1-01      ---ctaa

© 1998-2019