Dataset for CDS BOK of Organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9UL32_BOK-01      atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgc
Q9UMX3_BOK-03      atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgc
                   ******************** *********** ** ******************** ***

Q9UL32_BOK-01      tggcccacagacaaggagctggtggcccaggctaaagcactaggccgggagtacgtgcac
Q9UMX3_BOK-03      tcgcccacagacaaggagctggtggcccaggccaaggcgctgggccgggagtacgtgcac
                   * ****************************** ** ** ** ******************

Q9UL32_BOK-01      gcgcggcttttgcgcgccggcctctcctggagcgctccagagcgtgcctcgcctgcccct
Q9UMX3_BOK-03      gcgcggctgctgcgcgccggcctctcctggagcgcgcccgagcgtgccgcgccggtccc-
                   ********  ************************* ** ********* **** * *** 

Q9UL32_BOK-01      ggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
Q9UMX3_BOK-03      --gggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcgatgagctggagatg
                      *********** ********* * ************ **** ************  *

Q9UL32_BOK-01      atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccctctgcagtctgag
Q9UMX3_BOK-03      atccggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgag
                   ***** ******** ** ** ** ***** ** ************ * ************

Q9UL32_BOK-01      cctgtggtgactgatgccttcctcgctgtggccggccacatcttctcagcaggtatcaca
Q9UMX3_BOK-03      cctgtggtgaccgatgcgttcctggccgtggctggccacatcttctctgcaggcatcacg
                   *********** ***** ***** ** ***** ************** ***** ***** 

Q9UL32_BOK-01      tggggcaaggtagtgtccctgtactcggcggctgcgggactagcggtggactgcgtccgg
Q9UMX3_BOK-03      tggggcaaggtggtgtccctgtatgcggtggccgcggggctggccgtggactgtgtgagg
                   *********** ***********  *** *** ***** ** ** ******** **  **

Q9UL32_BOK-01      caagctcagccagccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
Q9UMX3_BOK-03      caggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgcaag
                   ** ** ***** ******** ** ***** ** ************** ** ** ******

Q9UL32_BOK-01      accttggctacctggcttcggaggcgtggtggatggacggacgtcctcaagtgtgtggtc
Q9UMX3_BOK-03      accctggcaacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtc
                   *** **** ******** ***** ** ** ******** ** ******************

Q9UL32_BOK-01      agcacaaaacctggcttccgctcccactggctcgtggccacactctgcagctttggccgc
Q9UMX3_BOK-03      agcacagaccctggcctccgctcccactggctggtggctgcactctgcagcttcggccgc
                   ****** * ****** **************** *****  ************* ******

Q9UL32_BOK-01      ttcctgaaggctgcattcttcctcctgttgccagagagatga
Q9UMX3_BOK-03      ttcctgaaggctgccttcttcgtgctgctgccagagagatga
                   ************** ****** * *** **************

© 1998-2018