Dataset for CDS BAX-like of Organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q9UL32_BOK-01          atgga-ggtgctgcggcgctcttcgg-tcttcgctgcggagatcatggac
Q9UMX3_BOK-03          atgga-ggtgctgcggcgctcctcgg-tcttcgccgccgagatcatggac
Q07812_BAX-10          atggacgggtccggggagcagcccag--------aggcggggg-------
Q07812_BAX-13          --------------------------------------------------
Q07812_BAX-06          atggacgggtccggggagcagcccag--------aggcggggg-------
Q07812_BAX-14          atggacgggtccggggagcagcccag--------aggcggg---------
Q07812_BAX-08          atggacgggtccggggagcagcccag--------aggcggg---------
Q07812_BAX-07          atggacgggtccggggagcagcccag--------aggcggggg-------
Q07812_BAX-03          atggacgggtccggggagcagcccag--------aggcggggg-------
A0A0C4MWS3_BAX-01      atggacgggtccggggagcagcccag--------aggcggg---------
A0A0C4MW46_BAX-01      atggacgggtccggggagcagcccag--------aggc--g---------
A0A0C4MVT1_BAX-01      atggacgggtccggggagcagcccag--------aggc--g---------
Q07812_BAX-05          atggacgggtccggggagcagcccag--------aggc--g---------
B4E0L2_BAK1-01         ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag
Q16611_BAK1-02         ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag
A8K7S8_BAK1-01         ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag
Q8NFF3_BAK1-01         ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgtggag
Q16611_BAK1-03         ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag
B3KRK7_BAK1-01         --------------------------------------------------
B4DEB4_BAK1-01         ----atggcttc--------------------------------------
Q16611_BAK1-01         ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag

Q9UL32_BOK-01          gcctttgatcgctggcccacagacaaggagctggtggcccaggctaaagc
Q9UMX3_BOK-03          gcctttgaccgctcgcccacagacaaggagctggtggcccaggccaaggc
Q07812_BAX-10          ----------gccc-accagctctgagcagatcatga--------aga--
Q07812_BAX-13          --------------------------------------------------
Q07812_BAX-06          ----------gccc-accagctctgagcagatcatga--------aga--
Q07812_BAX-14          --------------------------------------------------
Q07812_BAX-08          --------------------------------------------------
Q07812_BAX-07          ----------gccc-accagctctgagcagatcatga--------aga--
Q07812_BAX-03          ----------gccc-accagctctgagcagatcatga--------aga--
A0A0C4MWS3_BAX-01      --------------------------------------------------
A0A0C4MW46_BAX-01      --------------------------------------------------
A0A0C4MVT1_BAX-01      --------------------------------------------------
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacaca--
Q16611_BAK1-02         agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacaca--
A8K7S8_BAK1-01         agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacaca--
Q8NFF3_BAK1-01         agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacaca--
Q16611_BAK1-03         agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacaca--
B3KRK7_BAK1-01         --------------------------------------------------
B4DEB4_BAK1-01         -----------------------tgaggagcaggtagcccaggacaca--
Q16611_BAK1-01         agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacaca--

Q9UL32_BOK-01          actaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcct
Q9UMX3_BOK-03          gctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctctcct
Q07812_BAX-10          ----------------------caggggcccttttgcttcagggtttcat
Q07812_BAX-13          --------------------------------------------------
Q07812_BAX-06          ----------------------caggggcccttttgcttcagggtttcat
Q07812_BAX-14          -----------------------------------------ggttttcat
Q07812_BAX-08          -----------------------------------------ggg--ccca
Q07812_BAX-07          ----------------------caggggcccttttgcttcagggtttcat
Q07812_BAX-03          ----------------------caggggcccttttgcttcagggtttcat
A0A0C4MWS3_BAX-01      -----------------------------------------gggtttcat
A0A0C4MW46_BAX-01      -----------------------------------------gggtttcat
A0A0C4MVT1_BAX-01      -----------------------------------------gggtttcat
Q07812_BAX-05          -----------------------------------------gggtttcat
B4E0L2_BAK1-01         ----------------------gaggaggttttccgcagctacgtttttt
Q16611_BAK1-02         ----------------------gaggaggttttccgcagctacgtttttt
A8K7S8_BAK1-01         ----------------------gaggaggttttccgcagctacgtttttt
Q8NFF3_BAK1-01         ----------------------gaggaggttttccgcagctacgtttttt
Q16611_BAK1-03         ----------------------gaggaggttttccgcagctacgtttttt
B3KRK7_BAK1-01         --------------------------------------------------
B4DEB4_BAK1-01         ----------------------gaggaggttttccgcagctacgtttttt
Q16611_BAK1-01         ----------------------gaggaggttttccgcagctacgtttttt

Q9UL32_BOK-01          ggagcgctccagagcgtg-------------------------cctcgcc
Q9UMX3_BOK-03          ggagcgcgcccgagcgtg-------------------------ccgcgcc
Q07812_BAX-10          ccagg---atcgagcagg----gcgaat-ggggggggaggcacccgagct
Q07812_BAX-13          --------------------------------------------------
Q07812_BAX-06          ccagg---atcgagcagg----gcgaat-ggggggggaggcacccgagct
Q07812_BAX-14          ccagg---atcgagcagg----gcgaat--gggggggaggcacccgagct
Q07812_BAX-08          ccagc---tctgagcag---------atcatgaagacagg----------
Q07812_BAX-07          ccagg---atcgagcagg----gcgaat-ggggggggaggcacccgagct
Q07812_BAX-03          ccagg---atcgagcagg----gcgaat-ggggggggaggcacccgagct
A0A0C4MWS3_BAX-01      ccagg---atcgagcagg----gcgaat--gggggggaggcacccgagct
A0A0C4MW46_BAX-01      ccagg---atcgagcagg----gcgaatgggggggggaggcacccgagct
A0A0C4MVT1_BAX-01      ccagg---atcgagcagg----gcgaatgggggggggaggcacccgagct
Q07812_BAX-05          ccagg---atcgagcagg----gcgaat-ggggggggaggcacccgagct
B4E0L2_BAK1-01         accgc---catcagcaggaacaggaggctgaaggggtggctgcccctgcc
Q16611_BAK1-02         accgc---catcagcaggaacaggaggctgaaggggtggctgcccctgcc
A8K7S8_BAK1-01         accgc---catcagcaggaacaggaggctgaaggggtggctgcccctgcc
Q8NFF3_BAK1-01         accgc---catca-------------------------------------
Q16611_BAK1-03         accgc---catcagca----------------------------------
B3KRK7_BAK1-01         --------------------------------------------------
B4DEB4_BAK1-01         accgc---catcagcaggaacaggaggctgaaggggtggctgcccctgcc
Q16611_BAK1-01         accgc---catcagcaggaacaggaggctgaaggggtggctgcccctgcc

Q9UL32_BOK-01          tgcccctgga-ggacgcctggc----agaggtgtgcaccgtgctgctgcg
Q9UMX3_BOK-03          ggtccc---g-ggacgcctggc----tgaggtgtgcgcggtgctgctgcg
Q07812_BAX-10          ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
Q07812_BAX-13          --------------------------------------------------
Q07812_BAX-06          ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
Q07812_BAX-14          ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
Q07812_BAX-08          -----------ggcccttttgcttcagg----------------------
Q07812_BAX-07          ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
Q07812_BAX-03          ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
A0A0C4MWS3_BAX-01      ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
A0A0C4MW46_BAX-01      ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
A0A0C4MVT1_BAX-01      ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
Q07812_BAX-05          ggccc-----tggacccggtgcctcaggatgcgtccacca------agaa
B4E0L2_BAK1-01         gacccagagatggtcaccttacctctgcaacctagcagcaccatggggca
Q16611_BAK1-02         gacccagagatggtcaccttacctctgcaacctagcagcaccatggggca
A8K7S8_BAK1-01         gacccagagatggtcaccttacctctgcaacctagcagcaccatggggca
Q8NFF3_BAK1-01         --------------------------gcaacctagcagcaccatggggca
Q16611_BAK1-03         --------------------------gcaacctagcagcaccatggggca
B3KRK7_BAK1-01         ------------------------------------------atggggca
B4DEB4_BAK1-01         gacccagagatggtcaccttacctctgcaacctagcagcaccatggggca
Q16611_BAK1-01         gacccagagatggtcaccttacctctgcaacctagcagcaccatggggca

Q9UL32_BOK-01          cttgggagatgagctggagcagatccgtcccagcgtatatcg-gaatgtg
Q9UMX3_BOK-03          cctgggcgatgagctggagatgatccggcccagcgtctaccg-caacgtg
Q07812_BAX-10          gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
Q07812_BAX-13          --------------------------------------------------
Q07812_BAX-06          gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
Q07812_BAX-14          gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
Q07812_BAX-08          --------------------------------------------------
Q07812_BAX-07          gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
Q07812_BAX-03          gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
A0A0C4MWS3_BAX-01      gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
A0A0C4MW46_BAX-01      gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
A0A0C4MVT1_BAX-01      gctgagcgagtgtctcaagcgcatcggggacgaactggacag------ta
Q07812_BAX-05          gctga---------------------------------------------
B4E0L2_BAK1-01         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg
Q16611_BAK1-02         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg
A8K7S8_BAK1-01         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg
Q8NFF3_BAK1-01         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg
Q16611_BAK1-03         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg
B3KRK7_BAK1-01         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg
B4DEB4_BAK1-01         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg
Q16611_BAK1-01         ggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatg

Q9UL32_BOK-01          gcccggcagctgcacatc---------cctctgcagtctgagcctgtggt
Q9UMX3_BOK-03          gcgcgtcagctgcacatc---------tccctgcagtctgagcctgtggt
Q07812_BAX-10          acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
Q07812_BAX-13          ------------------atgat--------tgccgccgtggacacagac
Q07812_BAX-06          acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
Q07812_BAX-14          acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
Q07812_BAX-08          ----------------ggatgat--------tgccgccgtggacacagac
Q07812_BAX-07          acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
Q07812_BAX-03          acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
A0A0C4MWS3_BAX-01      acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
A0A0C4MW46_BAX-01      acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
A0A0C4MVT1_BAX-01      acatgg-agctgcagaggatgat--------tgccgccgtggacacagac
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa
Q16611_BAK1-02         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa
A8K7S8_BAK1-01         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa
Q8NFF3_BAK1-01         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa
Q16611_BAK1-03         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa
B3KRK7_BAK1-01         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa
B4DEB4_BAK1-01         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa
Q16611_BAK1-01         actcag-agttccagaccatgttgcagcacctgcagcccacggcagagaa

Q9UL32_BOK-01          gactgatgc---cttcctcgctg---tggccgg-----------------
Q9UMX3_BOK-03          gaccgatgc---gttcctggccg---tggctgg-----------------
Q07812_BAX-10          tccccccgagaggtctttttccgag-tggcagc-----------------
Q07812_BAX-13          tccccccgagaggtctttttccgag-tggcagc-----------------
Q07812_BAX-06          tccccccgagaggtctttttccgag-tggcagc-----------------
Q07812_BAX-14          tccccccgagaggtctttttccgag-tggcagc-----------------
Q07812_BAX-08          tccccccgagaggtctttttccgag-tggcagc-----------------
Q07812_BAX-07          tccccccgagaggtctttttccgag-tggcagc-----------------
Q07812_BAX-03          tccccccgagaggtctttttccgag-tggcagc-----------------
A0A0C4MWS3_BAX-01      tccccccgagaggtctttttccgag-tggcagc-----------------
A0A0C4MW46_BAX-01      tccccccgagaggtctttttccgag-tggcagc-----------------
A0A0C4MVT1_BAX-01      tccccccgagaggtctttttccgag-tggcagc-----------------
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         tgcctatga---gtacttcaccaagattgccac-----------------
Q16611_BAK1-02         tgcctatga---gtacttcaccaagattgccaccaggccagcagcaacac
A8K7S8_BAK1-01         tgcctatga---gtacttcaccaagattgccac-----------------
Q8NFF3_BAK1-01         tgcctatga---gtacttcaccaagattgccac-----------------
Q16611_BAK1-03         tgcctatga---gtacttcaccaagattgccac-----------------
B3KRK7_BAK1-01         tgcctatga---gtacttcaccaagattgccac-----------------
B4DEB4_BAK1-01         tgcctatga---gtacttcaccaagattgccac-----------------
Q16611_BAK1-01         tgcctatga---gtacttcaccaagattgccac-----------------

Q9UL32_BOK-01          ccacatcttctcagcaggta---tcacatggggcaaggtagt-gtccctg
Q9UMX3_BOK-03          ccacatcttctctgcaggca---tcacgtggggcaaggtggt-gtccctg
Q07812_BAX-10          tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
Q07812_BAX-13          tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
Q07812_BAX-06          tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
Q07812_BAX-14          tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
Q07812_BAX-08          tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
Q07812_BAX-07          tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
Q07812_BAX-03          tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
A0A0C4MWS3_BAX-01      tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
A0A0C4MW46_BAX-01      tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
A0A0C4MVT1_BAX-01      tgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttt
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         ---cag--------------------------------------------
Q16611_BAK1-02         ccacagcctgtttgagagtggcatcaattggggccgtgtggtggctcttc
A8K7S8_BAK1-01         ---cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttc
Q8NFF3_BAK1-01         ---cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttc
Q16611_BAK1-03         ---cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttc
B3KRK7_BAK1-01         ---cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttc
B4DEB4_BAK1-01         ---cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttc
Q16611_BAK1-01         ---cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttc

Q9UL32_BOK-01          tactcggcggctgcgggactagcggtggactgcgtccggcaagctcagcc
Q9UMX3_BOK-03          tatgcggtggccgcggggctggccgtggactgtgtgaggcaggcccagcc
Q07812_BAX-10          tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
Q07812_BAX-13          tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
Q07812_BAX-06          tctactttgccagc-aaactggtgctcaagg-------------------
Q07812_BAX-14          tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
Q07812_BAX-08          tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
Q07812_BAX-07          tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
Q07812_BAX-03          tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
A0A0C4MWS3_BAX-01      tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
A0A0C4MW46_BAX-01      tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
A0A0C4MVT1_BAX-01      tctactttgccagc-aaactggtgctcaaggccctgtgcaccaaggtgcc
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         -gtaccccagccac-ctcc-------------ct----------------
Q16611_BAK1-02         tgggcttcggctac-cgtctggccctacacgtct----------------
A8K7S8_BAK1-01         tgggcttcggctac-cgtctggccctacacgtct----------------
Q8NFF3_BAK1-01         tgggcttcggctac-cgtctggccctacacgtct----------------
Q16611_BAK1-03         tgggcttcggctac-cgtctggccctacacgtct----------------
B3KRK7_BAK1-01         tgggcttcggctac-cgtctggccctacacgtct----------------
B4DEB4_BAK1-01         tgggcttcggctac-cgtctggccctacacgtct----------------
Q16611_BAK1-01         tgggcttcggctac-cgtctggccctacacgtct----------------

Q9UL32_BOK-01          agccatggttcatgccctggttgactgc-------------ctggggga-
Q9UMX3_BOK-03          tgccatggtccacgccctcgtggactgc-------------ctggggga-
Q07812_BAX-10          ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
Q07812_BAX-13          ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
Q07812_BAX-06          ----ctggcgtgaaatggcgtgatctgg-----------gctcactgcaa
Q07812_BAX-14          ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
Q07812_BAX-08          ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
Q07812_BAX-07          ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
Q07812_BAX-03          ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
A0A0C4MWS3_BAX-01      ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
A0A0C4MW46_BAX-01      ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
A0A0C4MVT1_BAX-01      ggaactgatcagaaccatcatgggctgg-----------a--cattgga-
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         -------------gccagc---------------------tccagtcac-
Q16611_BAK1-02         -------------accagcatggcctga----------------------
A8K7S8_BAK1-01         -------------accagcatggcccgactggcttcctaggccaggtga-
Q8NFF3_BAK1-01         -------------accagcatggcctgactggcttcctaggccaggtga-
Q16611_BAK1-03         -------------accagcatggcctgactggcttcctaggccaggtga-
B3KRK7_BAK1-01         -------------accagcatggcctgactggcttcctaggccaggtga-
B4DEB4_BAK1-01         -------------accagcatggcctgactggcttcctaggccaggtga-
Q16611_BAK1-01         -------------accagcatggcctgactggcttcctaggccaggtga-

Q9UL32_BOK-01          -------atttgtacgcaagaccttggctacctggcttcggaggcgtggt
Q9UMX3_BOK-03          -------gttcgtgcgcaagaccctggcaacctggctgcggagacgcggc
Q07812_BAX-10          ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
Q07812_BAX-13          ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
Q07812_BAX-06          cctctgcctc-----------------ctgggtt----caa-------gc
Q07812_BAX-14          ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
Q07812_BAX-08          ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
Q07812_BAX-07          ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
Q07812_BAX-03          ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
A0A0C4MWS3_BAX-01      ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
A0A0C4MW46_BAX-01      ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
A0A0C4MVT1_BAX-01      ---cttcctccgggagcggctgttgggctggatc----caagaccagggt
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         ---tcctct-----------g-tcatgtcacaaccataccataccctg--
Q16611_BAK1-02         --------------------------------------------------
A8K7S8_BAK1-01         ---cccgcttcgtggtcgact-tcatgctgcatcactgcattgcccggtg
Q8NFF3_BAK1-01         ---cccgcttcgtggtcgact-tcatgctgcatcactgcattgcccggtg
Q16611_BAK1-03         ---cccgcttcgtggtcgact-tcatgctgcatcactgcattgcccggtg
B3KRK7_BAK1-01         ---cccgcttcgtggtcgact-tcatgctgcatcactgcattgcccggtg
B4DEB4_BAK1-01         ---cccgcttcgtggtcgact-tcatgctgcatcactgcattgcccggtg
Q16611_BAK1-01         ---cccgcttcgtggtcgact-tcatgctgcatcactgcattgcccggtg

Q9UL32_BOK-01          ggatg---------------------------------------------
Q9UMX3_BOK-03          ggatg---------------------------------------------
Q07812_BAX-10          ggttgggtgagactcctcaa------------------------------
Q07812_BAX-13          ggttgggtgagactcctcaa------------------------------
Q07812_BAX-06          gattc---------------------------------------------
Q07812_BAX-14          ggttg---------------------------------------------
Q07812_BAX-08          ggttg---------------------------------------------
Q07812_BAX-07          ggttg---------------------------------------------
Q07812_BAX-03          ggttg---------------------------------------------
A0A0C4MWS3_BAX-01      ggttgggggctgcccctggccgagtcactgaagcgactgatgtccctgtc
A0A0C4MW46_BAX-01      ggttg---------------------------------------------
A0A0C4MVT1_BAX-01      ggttgggggctgcccctggccgagtcactgaagcgactgatgtccctgtc
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         --------------------------------------------------
Q16611_BAK1-02         --------------------------------------------------
A8K7S8_BAK1-01         gattg---------------------------------------------
Q8NFF3_BAK1-01         gattg---------------------------------------------
Q16611_BAK1-03         gattg---------------------------------------------
B3KRK7_BAK1-01         gattg---------------------------------------------
B4DEB4_BAK1-01         gattg---------------------------------------------
Q16611_BAK1-01         gattg---------------------------------------------

Q9UL32_BOK-01          ------------gacggacgtcctcaagtgtgtggtcagcacaaaacctg
Q9UMX3_BOK-03          ------------gactgatgtcctcaagtgtgtggtcagcacagaccctg
Q07812_BAX-10          ---------gcctcctcacccccaccaccgcgccctcaccaccgcccctg
Q07812_BAX-13          ---------gcctcctcacccccaccaccgcgccctcaccaccgcccctg
Q07812_BAX-06          ---------acctgcctcagcatcccaaggagctgggattacaggccctg
Q07812_BAX-14          ----ggacggcctcctctcctactttgggacgcccacgtggcagaccgtg
Q07812_BAX-08          ----ggacggcctcctctcctactttgggacgcccacgtggcagaccgtg
Q07812_BAX-07          -------------------------------------------gaccgtg
Q07812_BAX-03          ----ggacggcctcctctcctactttgggacgcccacgtggcagaccgtg
A0A0C4MWS3_BAX-01      tccaggacggcctcctctcctactttgggacgcccacgtggcagaccgtg
A0A0C4MW46_BAX-01      ----ggacggcctcctctcctactttgggacgcccacgtggcagaccgtg
A0A0C4MVT1_BAX-01      tccaggacggcctcctctcctactttgggacgcccacgtggcagaccgtg
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         --------------------------------------------------
Q16611_BAK1-02         --------------------------------------------------
A8K7S8_BAK1-01         --------------------cacagaggggtggctgggtggcagccctga
Q8NFF3_BAK1-01         --------------------cacagaggggtggctgggtggcagccctga
Q16611_BAK1-03         --------------------cacagaggggtggctgggtggcagccctga
B3KRK7_BAK1-01         --------------------cacagaggggtggctgggtggcagccctga
B4DEB4_BAK1-01         --------------------cacagaggggtggctgggtggcagccctga
Q16611_BAK1-01         --------------------cacagaggggtggctgggtggcagccctga

Q9UL32_BOK-01          gcttccgctcccactggctcgtggccacactctgc---------------
Q9UMX3_BOK-03          gcctccgctcccactggctggtggctgcactctgc---------------
Q07812_BAX-10          ccc-----------ca----------ccgtccctgccccccgccactcct
Q07812_BAX-13          ccc-----------ca----------ccgtccctgccccccgccactcct
Q07812_BAX-06          ---------------t----------gcaccaagg---------------
Q07812_BAX-14          ---------------a----------ccatctttg---------------
Q07812_BAX-08          ---------------a----------ccatctttg---------------
Q07812_BAX-07          ---------------a----------ccatctttg---------------
Q07812_BAX-03          ---------------a----------ccatctttg---------------
A0A0C4MWS3_BAX-01      ---------------a----------ccatctttg---------------
A0A0C4MW46_BAX-01      ---------------a----------ccatctttg---------------
A0A0C4MVT1_BAX-01      ---------------a----------ccatctttg---------------
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         ------------------------------cctg----------------
Q16611_BAK1-02         --------------------------------------------------
A8K7S8_BAK1-01         act-----------tgggcaatggtcccatcctga---------------
Q8NFF3_BAK1-01         act-----------tgggcaatggtcccatcctga---------------
Q16611_BAK1-03         act-----------tgggcaatggtcccatcctga---------------
B3KRK7_BAK1-01         act-----------tgggcaatggtcccatcctga---------------
B4DEB4_BAK1-01         act-----------tgggcaatggtcccatcctga---------------
Q16611_BAK1-01         act-----------tgggcaatggtcccatcctga---------------

Q9UL32_BOK-01          ---------------agctttggccgcttcctgaaggctgcattcttcct
Q9UMX3_BOK-03          ---------------agcttcggccgcttcctgaaggctgccttcttcgt
Q07812_BAX-10          ctgggaccctgggccttctggagcaggtcacagtggtgccctctccccat
Q07812_BAX-13          ctgggaccctgggccttctggagcaggtcacagtggtgccctctccccat
Q07812_BAX-06          ---------------tgccggaa---------------------------
Q07812_BAX-14          ---------------tggcgggagtgctcaccgc----ctcactcaccat
Q07812_BAX-08          ---------------tggcgggagtgctcaccgc----ctcactcaccat
Q07812_BAX-07          ---------------tggcgggagtgctcaccgc----ctcactcaccat
Q07812_BAX-03          ---------------tggcgggagtgctcaccgc----ctcactcaccat
A0A0C4MWS3_BAX-01      ---------------tggcgggagtgctcaccgc----ctcactcaccat
A0A0C4MW46_BAX-01      ---------------tggcgggagtgctcaccgc----ctcactcaccat
A0A0C4MVT1_BAX-01      ---------------tggcgggagtgctcaccgc----ctcactcaccat
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         --------------------------------------------------
Q16611_BAK1-02         --------------------------------------------------
A8K7S8_BAK1-01         ------------acgtgctggtggttctgggtgtggttctgttgggccag
Q8NFF3_BAK1-01         ------------acgtgctggtggttctgggtgtggttctgttgggccag
Q16611_BAK1-03         ------------acgtgctggtggttctgggtgtggttctgttgggccag
B3KRK7_BAK1-01         ------------acgtgctggtggttctgggtgtggttctgttgggccag
B4DEB4_BAK1-01         ------------acgtgctggtggttctgggtgtggttctgttgggccag
Q16611_BAK1-01         ------------acgtgctggtggttctgggtgtggttctgttgggccag

Q9UL32_BOK-01          cctgttgccagag------------------------------agatga-
Q9UMX3_BOK-03          gctgctgccagag------------------------------agatga-
Q07812_BAX-10          cttcagatcatcagatgtggtctataatgcgttttccttacgtgtctga-
Q07812_BAX-13          cttcagatcatcagatgtggtctataatgcgttttccttacgtgtctga-
Q07812_BAX-06          ---------------------------------------------ctga-
Q07812_BAX-14          ctgga----agaagatg--------------------------ggctga-
Q07812_BAX-08          ctgga----agaagatg--------------------------ggctga-
Q07812_BAX-07          ctgga----agaagatg--------------------------ggctga-
Q07812_BAX-03          ctgga----agaagatg--------------------------ggctga-
A0A0C4MWS3_BAX-01      ctgga----agaagatg--------------------------ggctgag
A0A0C4MW46_BAX-01      ctgga----agaagatg--------------------------ggctga-
A0A0C4MVT1_BAX-01      ctgga----agaagatg--------------------------ggctgag
Q07812_BAX-05          --------------------------------------------------
B4E0L2_BAK1-01         --------------------------------------------catga-
Q16611_BAK1-02         --------------------------------------------------
A8K7S8_BAK1-01         tttgtggtacgaagatt-------------------cttcaaatcatga-
Q8NFF3_BAK1-01         tttgtggtacgaagatt-------------------cttcaaatcatga-
Q16611_BAK1-03         tttgtggtacgaagatt-------------------cttcaaatcatga-
B3KRK7_BAK1-01         tttgtggtacgaagatt-------------------cttcaaatcatga-
B4DEB4_BAK1-01         tttgtggtacgaagatt-------------------cttcaaatcatga-
Q16611_BAK1-01         tttgtggtacgaagatt-------------------cttcaaatcatga-

Q9UL32_BOK-01          -------------------------------------
Q9UMX3_BOK-03          -------------------------------------
Q07812_BAX-10          -------------------------------------
Q07812_BAX-13          -------------------------------------
Q07812_BAX-06          -------------------------------------
Q07812_BAX-14          -------------------------------------
Q07812_BAX-08          -------------------------------------
Q07812_BAX-07          -------------------------------------
Q07812_BAX-03          -------------------------------------
A0A0C4MWS3_BAX-01      gcccccagctgccttggactgtgtttttcctccataa
A0A0C4MW46_BAX-01      -------------------------------------
A0A0C4MVT1_BAX-01      gcccccagctgccttggactgtgtttttcctccataa
Q07812_BAX-05          -------------------------------------
B4E0L2_BAK1-01         -------------------------------------
Q16611_BAK1-02         -------------------------------------
A8K7S8_BAK1-01         -------------------------------------
Q8NFF3_BAK1-01         -------------------------------------
Q16611_BAK1-03         -------------------------------------
B3KRK7_BAK1-01         -------------------------------------
B4DEB4_BAK1-01         -------------------------------------
Q16611_BAK1-01         -------------------------------------

© 1998-2019