Dataset for CDS BAX of Organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I6LPK7_BAX-10          atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
I6LPK7_BAX-13          --------------------------------------------------
I6LPK7_BAX-06          atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
I6LPK7_BAX-14          atggacgggtccggggagcagcccagaggcggg-----------------
I6LPK7_BAX-08          atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
I6LPK7_BAX-07          atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
I6LPK7_BAX-03          atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A0C4MWS3_BAX-01      atggacgggtccggggagcagcccagaggcggg-----------------
A0A0C4MW46_BAX-01      atggacgggtccggggagcagcccagaggc--g-----------------
A0A0C4MVT1_BAX-01      atggacgggtccggggagcagcccagaggc--g-----------------
I6LPK7_BAX-05          atggacgggtccggggagcagcccagaggc--g-----------------
                                                                         

I6LPK7_BAX-10          gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
I6LPK7_BAX-13          --------------------------------------------------
I6LPK7_BAX-06          gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
I6LPK7_BAX-14          ---------------------------------ggttttcatccaggatc
I6LPK7_BAX-08          gcagatcatgaagacaggggcccttt------------------------
I6LPK7_BAX-07          gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
I6LPK7_BAX-03          gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A0C4MWS3_BAX-01      ---------------------------------gggtttcatccaggatc
A0A0C4MW46_BAX-01      ---------------------------------gggtttcatccaggatc
A0A0C4MVT1_BAX-01      ---------------------------------gggtttcatccaggatc
I6LPK7_BAX-05          ---------------------------------gggtttcatccaggatc
                                                                         

I6LPK7_BAX-10          gagcagggcgaat-ggggggggaggcacccgagctggccctggacccggt
I6LPK7_BAX-13          --------------------------------------------------
I6LPK7_BAX-06          gagcagggcgaat-ggggggggaggcacccgagctggccctggacccggt
I6LPK7_BAX-14          gagcagggcgaat--gggggggaggcacccgagctggccctggacccggt
I6LPK7_BAX-08          -------------------------------------------------t
I6LPK7_BAX-07          gagcagggcgaat-ggggggggaggcacccgagctggccctggacccggt
I6LPK7_BAX-03          gagcagggcgaat-ggggggggaggcacccgagctggccctggacccggt
A0A0C4MWS3_BAX-01      gagcagggcgaat--gggggggaggcacccgagctggccctggacccggt
A0A0C4MW46_BAX-01      gagcagggcgaatgggggggggaggcacccgagctggccctggacccggt
A0A0C4MVT1_BAX-01      gagcagggcgaatgggggggggaggcacccgagctggccctggacccggt
I6LPK7_BAX-05          gagcagggcgaat-ggggggggaggcacccgagctggccctggacccggt
                                                                         

I6LPK7_BAX-10          gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
I6LPK7_BAX-13          --------------------------------------------------
I6LPK7_BAX-06          gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
I6LPK7_BAX-14          gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
I6LPK7_BAX-08          gcttcagg------------------------------------------
I6LPK7_BAX-07          gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
I6LPK7_BAX-03          gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
A0A0C4MWS3_BAX-01      gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
A0A0C4MW46_BAX-01      gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
A0A0C4MVT1_BAX-01      gcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
I6LPK7_BAX-05          gcctcaggatgcgtccaccaagaagctga---------------------
                                                                         

I6LPK7_BAX-10          gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
I6LPK7_BAX-13          -----------------------------------atgattgccgccgtg
I6LPK7_BAX-06          gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
I6LPK7_BAX-14          gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
I6LPK7_BAX-08          ---------------------------------ggatgattgccgccgtg
I6LPK7_BAX-07          gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
I6LPK7_BAX-03          gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
A0A0C4MWS3_BAX-01      gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
A0A0C4MW46_BAX-01      gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
A0A0C4MVT1_BAX-01      gggacgaactggacagtaacatggagctgcagaggatgattgccgccgtg
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
I6LPK7_BAX-13          gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
I6LPK7_BAX-06          gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
I6LPK7_BAX-14          gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
I6LPK7_BAX-08          gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
I6LPK7_BAX-07          gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
I6LPK7_BAX-03          gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
A0A0C4MWS3_BAX-01      gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
A0A0C4MW46_BAX-01      gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
A0A0C4MVT1_BAX-01      gacacagactccccccgagaggtctttttccgagtggcagctgacatgtt
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
I6LPK7_BAX-13          ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
I6LPK7_BAX-06          ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
I6LPK7_BAX-14          ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
I6LPK7_BAX-08          ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
I6LPK7_BAX-07          ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
I6LPK7_BAX-03          ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A0C4MWS3_BAX-01      ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A0C4MW46_BAX-01      ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A0C4MVT1_BAX-01      ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
I6LPK7_BAX-13          ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
I6LPK7_BAX-06          ccagcaaactggtgctcaaggc----tggcgtgaaatggcg----tgatc
I6LPK7_BAX-14          ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
I6LPK7_BAX-08          ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
I6LPK7_BAX-07          ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
I6LPK7_BAX-03          ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
A0A0C4MWS3_BAX-01      ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
A0A0C4MW46_BAX-01      ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
A0A0C4MVT1_BAX-01      ccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatc
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
I6LPK7_BAX-13          agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
I6LPK7_BAX-06          ----------tgggct---cactgcaacctctgcctc-------------
I6LPK7_BAX-14          agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
I6LPK7_BAX-08          agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
I6LPK7_BAX-07          agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
I6LPK7_BAX-03          agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
A0A0C4MWS3_BAX-01      agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
A0A0C4MW46_BAX-01      agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
A0A0C4MVT1_BAX-01      agaaccatcatgggctggacattgga----cttcctccgggagcggctgt
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          tgggctggatccaagaccagggtggttgggtgagactcctcaa-------
I6LPK7_BAX-13          tgggctggatccaagaccagggtggttgggtgagactcctcaa-------
I6LPK7_BAX-06          ----ctgggttcaa-------gcgattc----------------------
I6LPK7_BAX-14          tgggctggatccaagaccagggtggttg----------------------
I6LPK7_BAX-08          tgggctggatccaagaccagggtggttg----------------------
I6LPK7_BAX-07          tgggctggatccaagaccagggtggttg----------------------
I6LPK7_BAX-03          tgggctggatccaagaccagggtggttg----------------------
A0A0C4MWS3_BAX-01      tgggctggatccaagaccagggtggttgggggctgcccctggccgagtca
A0A0C4MW46_BAX-01      tgggctggatccaagaccagggtggttg----------------------
A0A0C4MVT1_BAX-01      tgggctggatccaagaccagggtggttgggggctgcccctggccgagtca
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          --------------------------------gcctcctcacccccacca
I6LPK7_BAX-13          --------------------------------gcctcctcacccccacca
I6LPK7_BAX-06          --------------------------------acctgcctcagcatccca
I6LPK7_BAX-14          ---------------------------ggacggcctcctctcctactttg
I6LPK7_BAX-08          ---------------------------ggacggcctcctctcctactttg
I6LPK7_BAX-07          --------------------------------------------------
I6LPK7_BAX-03          ---------------------------ggacggcctcctctcctactttg
A0A0C4MWS3_BAX-01      ctgaagcgactgatgtccctgtctccaggacggcctcctctcctactttg
A0A0C4MW46_BAX-01      ---------------------------ggacggcctcctctcctactttg
A0A0C4MVT1_BAX-01      ctgaagcgactgatgtccctgtctccaggacggcctcctctcctactttg
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          ccgcgccctcaccaccgcccctgccccaccgtccctgccccccgccactc
I6LPK7_BAX-13          ccgcgccctcaccaccgcccctgccccaccgtccctgccccccgccactc
I6LPK7_BAX-06          aggagctgggattacaggccctgtgc------------------------
I6LPK7_BAX-14          ggacgcccacgtggcagaccgtgacc------------------------
I6LPK7_BAX-08          ggacgcccacgtggcagaccgtgacc------------------------
I6LPK7_BAX-07          ----------------gaccgtgacc------------------------
I6LPK7_BAX-03          ggacgcccacgtggcagaccgtgacc------------------------
A0A0C4MWS3_BAX-01      ggacgcccacgtggcagaccgtgacc------------------------
A0A0C4MW46_BAX-01      ggacgcccacgtggcagaccgtgacc------------------------
A0A0C4MVT1_BAX-01      ggacgcccacgtggcagaccgtgacc------------------------
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          ctctgggaccctgggccttctggagcaggtcacagtggtgccctctcccc
I6LPK7_BAX-13          ctctgggaccctgggccttctggagcaggtcacagtggtgccctctcccc
I6LPK7_BAX-06          -------accaagg---tgccggaa-------------------------
I6LPK7_BAX-14          -------atctttg---tggcgggagtgctcaccgc----ctcactcacc
I6LPK7_BAX-08          -------atctttg---tggcgggagtgctcaccgc----ctcactcacc
I6LPK7_BAX-07          -------atctttg---tggcgggagtgctcaccgc----ctcactcacc
I6LPK7_BAX-03          -------atctttg---tggcgggagtgctcaccgc----ctcactcacc
A0A0C4MWS3_BAX-01      -------atctttg---tggcgggagtgctcaccgc----ctcactcacc
A0A0C4MW46_BAX-01      -------atctttg---tggcgggagtgctcaccgc----ctcactcacc
A0A0C4MVT1_BAX-01      -------atctttg---tggcgggagtgctcaccgc----ctcactcacc
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          atcttcagatcatcagatgtggtctataatgcgttttccttacgtgtctg
I6LPK7_BAX-13          atcttcagatcatcagatgtggtctataatgcgttttccttacgtgtctg
I6LPK7_BAX-06          -----------------------------------------------ctg
I6LPK7_BAX-14          atctgga----agaagatg--------------------------ggctg
I6LPK7_BAX-08          atctgga----agaagatg--------------------------ggctg
I6LPK7_BAX-07          atctgga----agaagatg--------------------------ggctg
I6LPK7_BAX-03          atctgga----agaagatg--------------------------ggctg
A0A0C4MWS3_BAX-01      atctgga----agaagatg--------------------------ggctg
A0A0C4MW46_BAX-01      atctgga----agaagatg--------------------------ggctg
A0A0C4MVT1_BAX-01      atctgga----agaagatg--------------------------ggctg
I6LPK7_BAX-05          --------------------------------------------------
                                                                         

I6LPK7_BAX-10          a--------------------------------------
I6LPK7_BAX-13          a--------------------------------------
I6LPK7_BAX-06          a--------------------------------------
I6LPK7_BAX-14          a--------------------------------------
I6LPK7_BAX-08          a--------------------------------------
I6LPK7_BAX-07          a--------------------------------------
I6LPK7_BAX-03          a--------------------------------------
A0A0C4MWS3_BAX-01      aggcccccagctgccttggactgtgtttttcctccataa
A0A0C4MW46_BAX-01      a--------------------------------------
A0A0C4MVT1_BAX-01      aggcccccagctgccttggactgtgtttttcctccataa
I6LPK7_BAX-05          ---------------------------------------
                                                              

© 1998-2018