Dataset for CDS BAK1 of Organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B4E0L2_BAK1-01      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccc
Q16611_BAK1-02      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccc
A8K7S8_BAK1-01      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccc
Q8NFF3_BAK1-01      atggcttcggggcaaggcccaggtcctcccaggcaggagtgtggagagcctgccctgccc
Q16611_BAK1-03      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccc
B3KRK7_BAK1-01      ------------------------------------------------------------
B4DEB4_BAK1-01      atg---------------------------------------------------------
Q16611_BAK1-01      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccc
                                                                                

B4E0L2_BAK1-01      tctgcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttt
Q16611_BAK1-02      tctgcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttt
A8K7S8_BAK1-01      tctgcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttt
Q8NFF3_BAK1-01      tctgcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttt
Q16611_BAK1-03      tctgcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttt
B3KRK7_BAK1-01      ------------------------------------------------------------
B4DEB4_BAK1-01      ---gcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttt
Q16611_BAK1-01      tctgcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttt
                                                                                

B4E0L2_BAK1-01      taccgccatcagcaggaacaggaggctgaaggggtggctgcccctgccgacccagagatg
Q16611_BAK1-02      taccgccatcagcaggaacaggaggctgaaggggtggctgcccctgccgacccagagatg
A8K7S8_BAK1-01      taccgccatcagcaggaacaggaggctgaaggggtggctgcccctgccgacccagagatg
Q8NFF3_BAK1-01      taccgccatca-------------------------------------------------
Q16611_BAK1-03      taccgccatcagca----------------------------------------------
B3KRK7_BAK1-01      ------------------------------------------------------------
B4DEB4_BAK1-01      taccgccatcagcaggaacaggaggctgaaggggtggctgcccctgccgacccagagatg
Q16611_BAK1-01      taccgccatcagcaggaacaggaggctgaaggggtggctgcccctgccgacccagagatg
                                                                                

B4E0L2_BAK1-01      gtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
Q16611_BAK1-02      gtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
A8K7S8_BAK1-01      gtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
Q8NFF3_BAK1-01      --------------gcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
Q16611_BAK1-03      --------------gcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
B3KRK7_BAK1-01      ------------------------------atggggcaggtgggacggcagctcgccatc
B4DEB4_BAK1-01      gtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
Q16611_BAK1-01      gtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
                                                  ******************************

B4E0L2_BAK1-01      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
Q16611_BAK1-02      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
A8K7S8_BAK1-01      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
Q8NFF3_BAK1-01      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
Q16611_BAK1-03      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
B3KRK7_BAK1-01      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
B4DEB4_BAK1-01      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
Q16611_BAK1-01      atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctg
                    ************************************************************

B4E0L2_BAK1-01      cagcccacggcagagaatgcctatgagtacttcaccaagattgccaccaggtaccc----
Q16611_BAK1-02      cagcccacggcagagaatgcctatgagtacttcaccaagattgccaccaggccagcagca
A8K7S8_BAK1-01      cagcccacggcagagaatgcctatgagtacttcaccaagattgccac-------------
Q8NFF3_BAK1-01      cagcccacggcagagaatgcctatgagtacttcaccaagattgccac-------------
Q16611_BAK1-03      cagcccacggcagagaatgcctatgagtacttcaccaagattgccac-------------
B3KRK7_BAK1-01      cagcccacggcagagaatgcctatgagtacttcaccaagattgccac-------------
B4DEB4_BAK1-01      cagcccacggcagagaatgcctatgagtacttcaccaagattgccac-------------
Q16611_BAK1-01      cagcccacggcagagaatgcctatgagtacttcaccaagattgccac-------------
                    ***********************************************             

B4E0L2_BAK1-01      -------cagcc-----------------------------------acctccctgccag
Q16611_BAK1-02      acacccacagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctg--gg
A8K7S8_BAK1-01      -------cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctg--gg
Q8NFF3_BAK1-01      -------cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctg--gg
Q16611_BAK1-03      -------cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctg--gg
B3KRK7_BAK1-01      -------cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctg--gg
B4DEB4_BAK1-01      -------cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctg--gg
Q16611_BAK1-01      -------cagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctg--gg
                           *****                                    *    ***   *

B4E0L2_BAK1-01      ctccagtcactcctctgtcatgtcacaacca-taccataccctgcctg------------
Q16611_BAK1-02      cttcggctac-cgtctggccctacacgtctaccagcatggcctga---------------
A8K7S8_BAK1-01      cttcggctac-cgtctggccctacacgtctaccagcatggcccgactggcttcctaggcc
Q8NFF3_BAK1-01      cttcggctac-cgtctggccctacacgtctaccagcatggcctgactggcttcctaggcc
Q16611_BAK1-03      cttcggctac-cgtctggccctacacgtctaccagcatggcctgactggcttcctaggcc
B3KRK7_BAK1-01      cttcggctac-cgtctggccctacacgtctaccagcatggcctgactggcttcctaggcc
B4DEB4_BAK1-01      cttcggctac-cgtctggccctacacgtctaccagcatggcctgactggcttcctaggcc
Q16611_BAK1-01      cttcggctac-cgtctggccctacacgtctaccagcatggcctgactggcttcctaggcc
                    ** * *  ** * **** *    ***  * *  * ***  ** *                

B4E0L2_BAK1-01      ------------------------------------------------------------
Q16611_BAK1-02      ------------------------------------------------------------
A8K7S8_BAK1-01      aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
Q8NFF3_BAK1-01      aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
Q16611_BAK1-03      aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
B3KRK7_BAK1-01      aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
B4DEB4_BAK1-01      aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
Q16611_BAK1-01      aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
                                                                                

B4E0L2_BAK1-01      ------------------------------------------------------------
Q16611_BAK1-02      ------------------------------------------------------------
A8K7S8_BAK1-01      agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
Q8NFF3_BAK1-01      agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
Q16611_BAK1-03      agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
B3KRK7_BAK1-01      agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
B4DEB4_BAK1-01      agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
Q16611_BAK1-01      agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
                                                                                

B4E0L2_BAK1-01      ------------------------------------------------------catga
Q16611_BAK1-02      -----------------------------------------------------------
A8K7S8_BAK1-01      tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
Q8NFF3_BAK1-01      tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
Q16611_BAK1-03      tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
B3KRK7_BAK1-01      tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
B4DEB4_BAK1-01      tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
Q16611_BAK1-01      tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
                                                                               

© 1998-2018