Dataset for CDS BAX-like of Organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3RTU9_BAX-05           atggacg-ggtccggggagcagcccag------------aggcggggggc
G3RTU9_BAX-02           atggacg-ggtccggggagca-----------------------------
G3RTU9_BAX-03           atggacg-ggtccggggagcagcccag------------aggcggggtga
G3RTU9_BAX-01           atggacg-ggtccggggagcagcccag------------aggcggggggc
G3RTU9_BAX-04           atggacg-ggtccggggagcagcccag------------aggcggggggc
A0A2I2ZF28_BOK-01       atggaggtgctgcggcgc---tcctcggtcttcgccgccgagatcatgga
A0A2I2Y8H5_BAK1-01      atg-----gcatcggggcaaggcccagggcctcccaggcaggagtgcgga
G3RSX3_BAK1-02          atg-----gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
G3RSX3_BAK1-03          atg-----gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
G3RSX3_BAK1-01          atg-----gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
                        ***     *   *** *                                 

G3RTU9_BAX-05           ccaccagctctgagc------------agatcatgaagacaggggccct-
G3RTU9_BAX-02           --------------------------------------------------
G3RTU9_BAX-03           cacctcgttctga-----------------------------------t-
G3RTU9_BAX-01           ccaccagctctgagc------------agatcatgaagacaggggccct-
G3RTU9_BAX-04           ccaccagctctgagc------------agatcatgaagacaggggccct-
A0A2I2ZF28_BOK-01       cgcctttgaccgctcgcccacagacaaggagctggtggcccaggccaagg
A0A2I2Y8H5_BAK1-01      aagcctgccctgcgc-tctgcttctgaggagcaggtagcccaggacacgg
G3RSX3_BAK1-02          gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
G3RSX3_BAK1-03          gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
G3RSX3_BAK1-01          gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
                                                                          

G3RTU9_BAX-05           ----------------------tttgcttcagggtttcatccaggatcga
G3RTU9_BAX-02           ----------------------------------tttcatccaggatcga
G3RTU9_BAX-03           ----------------------tctgcaccctcactccatccccactcta
G3RTU9_BAX-01           ----------------------tttgcttcagggtttcatccaggatcga
G3RTU9_BAX-04           ----------------------tttgcttcagg-----------------
A0A2I2ZF28_BOK-01       cgctgggccgggagtacgtgcacgcgcggctac--tgcgcgccggcctct
A0A2I2Y8H5_BAK1-01      agg-ggttt-------------tccgcagctaca----------------
G3RSX3_BAK1-02          aggaggttt-------------tccgcagctacgttttttaccgccatca
G3RSX3_BAK1-03          aggaggttt-------------tccgcagctacgttttttaccgccatca
G3RSX3_BAK1-01          aggaggttt-------------tccgcagctacgttttttaccgccatca
                                                                          

G3RTU9_BAX-05           gcagg-----gcgaatggggggggaggcacccgagct--ggccctggacc
G3RTU9_BAX-02           gcagg-----gcgaatggggggggaggcacccgagct--ggccctggacc
G3RTU9_BAX-03           ----g-----gcgaatggggggggaggcacccgagct--ggccctggacc
G3RTU9_BAX-01           gcagg-----gcgaatggggggggaggcacccgagct--ggccctggacc
G3RTU9_BAX-04           --------------------------------------------------
A0A2I2ZF28_BOK-01       cctggagcgcgc---------ccgagcgcgccgcgcc--ggtcccgggac
A0A2I2Y8H5_BAK1-01      ---------------------gatggcaccctgcgcc-------------
G3RSX3_BAK1-02          gcagaacc---------------------cctctgccatgagcca-----
G3RSX3_BAK1-03          gcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagagat
G3RSX3_BAK1-01          gcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagagat
                                                                          

G3RTU9_BAX-05           cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
G3RTU9_BAX-02           cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
G3RTU9_BAX-03           cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
G3RTU9_BAX-01           cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
G3RTU9_BAX-04           --------------------------------------------------
A0A2I2ZF28_BOK-01       gcctggctgaggtgtgc------gcggtgctgctgcgcctgggcgatg--
A0A2I2Y8H5_BAK1-01      --------------tccaacctagaagcaccatggggcaggtgggacggc
G3RSX3_BAK1-02          ---------------------------------gggcctggtgggacggc
G3RSX3_BAK1-03          ggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggc
G3RSX3_BAK1-01          ggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggc
                                                                          

G3RTU9_BAX-05           gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
G3RTU9_BAX-02           gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
G3RTU9_BAX-03           gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
G3RTU9_BAX-01           gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
G3RTU9_BAX-04           --------------------------------------------------
A0A2I2ZF28_BOK-01       agctggagatgatccggcccagcgtctaccg-caacgtggcacgtcagct
A0A2I2Y8H5_BAK1-01      agctcgccatcacc-aggacgacatcaaccggcactatgacttcggagtt
G3RSX3_BAK1-02          agctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagtt
G3RSX3_BAK1-03          agctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagtt
G3RSX3_BAK1-01          agctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagtt
                                                                          

G3RTU9_BAX-05           gcagaggatgat--------tgccgccgtggacacagactccccccgaga
G3RTU9_BAX-02           gcagaggatgat--------tgccgccgtggacacagactccccccgaga
G3RTU9_BAX-03           gcagaggatgat--------tgccgccgtggacacagactccccccgaga
G3RTU9_BAX-01           gcagaggatgat--------tgccgccgtggacacagactccccccgaga
G3RTU9_BAX-04           -----ggatgat--------tgccgccgtggacacagactccccccgaga
A0A2I2ZF28_BOK-01       gcacatc---------tccctgcagtctgagcctgtggtgaccgatgcg-
A0A2I2Y8H5_BAK1-01      ccagaccatgctgcagcgtctgcagcccagggcagagaacgcctacgag-
G3RSX3_BAK1-02          ccagaccatgttgcagcacctgcagcccacggcagagaatgcctatgag-
G3RSX3_BAK1-03          ccagaccatgttgcagcacctgcagcccacggcagagaatgcctatgag-
G3RSX3_BAK1-01          ccagaccatgttgcagcacctgcagcccacggcagagaatgcctatgag-
                                            *** * *   * *   *    **   * * 

G3RTU9_BAX-05           ggtctttttccgagtggcagctga--------------------catgtt
G3RTU9_BAX-02           ggtctttttccgagtggcagctga--------------------catgtt
G3RTU9_BAX-03           ggtctttttccgagtggcagctga--------------------catgtt
G3RTU9_BAX-01           ggtctttttccgagtggcagctga--------------------catgtt
G3RTU9_BAX-04           ggtctttttccgagtggcagctga--------------------catgtt
A0A2I2ZF28_BOK-01       ----ttcctggccgtggctggcca--------------------catctt
A0A2I2Y8H5_BAK1-01      ----tacttcaccaagatcgcctc--------------------cagcct
G3RSX3_BAK1-02          ----tacttcaccaagattgccac--------------------cagcct
G3RSX3_BAK1-03          ----tacttcaccaagattgccaccaggccagcagcaacacccacagcct
G3RSX3_BAK1-01          ----tacttcaccaagattgccac--------------------cagcct
                            *   *      *   *                        **   *

G3RTU9_BAX-05           ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
G3RTU9_BAX-02           ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
G3RTU9_BAX-03           ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
G3RTU9_BAX-01           ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
G3RTU9_BAX-04           ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A2I2ZF28_BOK-01       ctctgca---ggcatcacgtggggcaaggtggtgtccct----gtatgcg
A0A2I2Y8H5_BAK1-01      gtttgagagtggcatcaaccggggccgtgtggtggctctcctgggcttcg
G3RSX3_BAK1-02          gtttgagagtggcatcaattggggccgtgtggtggctcttctgggcttcg
G3RSX3_BAK1-03          gtttgagagtggcatcaattggggccgtgtggtggctcttctgggcttcg
G3RSX3_BAK1-01          gtttgagagtggcatcaattggggccgtgtggtggctcttctgggcttcg
                         * **       * ***   *****   ** **  * **       *  *

G3RTU9_BAX-05           ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
G3RTU9_BAX-02           ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
G3RTU9_BAX-03           ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
G3RTU9_BAX-01           ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
G3RTU9_BAX-04           ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
A0A2I2ZF28_BOK-01       gtggccgcagggctggccgt----ggactgtgtgaggcaggcccagcctg
A0A2I2Y8H5_BAK1-01      gctaccgt----ctggtctt----acac-gtct---accagcacagcctg
G3RSX3_BAK1-02          gctaccgt----ctggccct----acac-gttt---accagcatggcctg
G3RSX3_BAK1-03          gctaccgt----ctggccct----acac-gttt---accagcatggcctg
G3RSX3_BAK1-01          gctaccgt----ctggccct----acac-gttt---accagcatggcctg
                            *       ****   *       * **      *        *   

G3RTU9_BAX-05           actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
G3RTU9_BAX-02           actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
G3RTU9_BAX-03           actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
G3RTU9_BAX-01           actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
G3RTU9_BAX-04           actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
A0A2I2ZF28_BOK-01       ccatg-gtccacgccctcgtggactgcctggggga---gttcgtgc----
A0A2I2Y8H5_BAK1-01      actggcttcctgggcctggtgacccgcttcgtggt---cttcatgctgca
G3RSX3_BAK1-02          actggcttcctaggccaggtgacccgcttcgtggttgacttcatgctgca
G3RSX3_BAK1-03          a-------------------------------------------------
G3RSX3_BAK1-01          actggcttcctaggccaggtgacccgcttcgtggttgacttcatgctgca
                                                                          

G3RTU9_BAX-05           gcg----gctgttgggctggatccaagaccagggtggttgggtg------
G3RTU9_BAX-02           gcg----gctgttgggctggatccaagaccagggtggttgggggctgccc
G3RTU9_BAX-03           gcg----gctgttgggctggatccaagaccagggtggttg----------
G3RTU9_BAX-01           gcg----gctgttgggctggatccaagaccagggtggttg----------
G3RTU9_BAX-04           gcg----gctgttgggctggatccaagaccagggtggttg----------
A0A2I2ZF28_BOK-01       gcaagaccctggcaacctggctgcggagacgcggcggatggactgatgtc
A0A2I2Y8H5_BAK1-01      acacggcattgcccggtggatctcgcaga-ggggcggctgggtggcagcc
G3RSX3_BAK1-02          tcactgcattgcccggtggattgcacaga-ggggtggctgggtggcagcc
G3RSX3_BAK1-03          --------------------------------------------------
G3RSX3_BAK1-01          tcactgcattgcccggtggattgcacaga-ggggtggctgggtggcagcc
                                                                          

G3RTU9_BAX-05           ---------------------------------------agactcctcaa
G3RTU9_BAX-02           ctggccgagtcactgaagcgactgatgtccctgtctccaggac------g
G3RTU9_BAX-03           ---------------------------------------ggac------g
G3RTU9_BAX-01           ---------------------------------------ggac------g
G3RTU9_BAX-04           ---------------------------------------ggac------g
A0A2I2ZF28_BOK-01       ctcaagtgtgtggtcagcac-------------------agaccct---g
A0A2I2Y8H5_BAK1-01      ccgga------------ctt-------------------gggcaat---a
G3RSX3_BAK1-02          ctgaa------------ctt-------------------gggcaat---g
G3RSX3_BAK1-03          --------------------------------------------------
G3RSX3_BAK1-01          ctgaa------------ctt-------------------gggcaat---g
                                                                          

G3RTU9_BAX-05           gcctcctcacccccaccaccacgccctcaccactgcccctgccccaccgt
G3RTU9_BAX-02           gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
G3RTU9_BAX-03           gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
G3RTU9_BAX-01           gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
G3RTU9_BAX-04           gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
A0A2I2ZF28_BOK-01       gcctccgctcccactggctggtagctgc-------actctgcagcttcg-
A0A2I2Y8H5_BAK1-01      gtcccatcctgaacgtgctggtggttgtgggtggggttctgctg----g-
G3RSX3_BAK1-02          gtcccatcctgaacgtgctggtggttctgggtgtggttctgttg----g-
G3RSX3_BAK1-03          --------------------------------------------------
G3RSX3_BAK1-01          gtcccatcctgaacgtgctggtggttctgggtgtggttctgttg----g-
                                                                          

G3RTU9_BAX-05           cccttccccccgccactcctctgggaccctgggccttctggagcaggtca
G3RTU9_BAX-02           -----------accatctttgtgg-------------cgggagt-gctca
G3RTU9_BAX-03           -----------accatctttgtgg-------------cgggagt-gctca
G3RTU9_BAX-01           -----------accatctttgtgg-------------cgggagt-gctca
G3RTU9_BAX-04           -----------accatctttgtgg-------------cgggagt-gctca
A0A2I2ZF28_BOK-01       -----------gccg-cttcctga-------------aggctgc------
A0A2I2Y8H5_BAK1-01      -----------gcca-gtttgtgg-------------taagaag------
G3RSX3_BAK1-02          -----------gcca-gtttgtgg-------------tacgaag------
G3RSX3_BAK1-03          --------------------------------------------------
G3RSX3_BAK1-01          -----------gcca-gtttgtgg-------------tacgaag------
                                                                          

G3RTU9_BAX-05           cagtggtgccctctccccatcttcagatcatcagatgtggtctataatgc
G3RTU9_BAX-02           ccgc----ctcactcaccatctgga----agaagatg-------------
G3RTU9_BAX-03           ccgc----ctcactcaccatctgga----agaagatg-------------
G3RTU9_BAX-01           ccgc----ctcactcaccatctgga----agaagatg-------------
G3RTU9_BAX-04           ccgc----ctcactcaccatctgga----agaagatg-------------
A0A2I2ZF28_BOK-01       --------cttcttcgtgctgctgc----cagagaga-------------
A0A2I2Y8H5_BAK1-01      --------attcttc----------------aaatca-------------
G3RSX3_BAK1-02          --------attcttc----------------aaatca-------------
G3RSX3_BAK1-03          --------------------------------------------------
G3RSX3_BAK1-01          --------attcttc----------------aaatca-------------
                                                                          

G3RTU9_BAX-05           gtttttacgtgtctga----------------------------------
G3RTU9_BAX-02           ----------ggctgaggcccccagctgccttggactgtgtttttcctcc
G3RTU9_BAX-03           ----------ggctga----------------------------------
G3RTU9_BAX-01           ----------ggctga----------------------------------
G3RTU9_BAX-04           ----------ggctga----------------------------------
A0A2I2ZF28_BOK-01       -------------tga----------------------------------
A0A2I2Y8H5_BAK1-01      -------------tga----------------------------------
G3RSX3_BAK1-02          -------------tga----------------------------------
G3RSX3_BAK1-03          --------------------------------------------------
G3RSX3_BAK1-01          -------------tga----------------------------------
                                                                          

G3RTU9_BAX-05           ----
G3RTU9_BAX-02           ataa
G3RTU9_BAX-03           ----
G3RTU9_BAX-01           ----
G3RTU9_BAX-04           ----
A0A2I2ZF28_BOK-01       ----
A0A2I2Y8H5_BAK1-01      ----
G3RSX3_BAK1-02          ----
G3RSX3_BAK1-03          ----
G3RSX3_BAK1-01          ----
                            

© 1998-2018