Dataset for CDS BAX of Organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3RTU9_BAX-05      atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatg
G3RTU9_BAX-02      atggacgggtccggggagca----------------------------------------
G3RTU9_BAX-03      atggacgggtccggggagcagcccagaggcggggtgacacctcgttctga----------
G3RTU9_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatg
G3RTU9_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatg

G3RTU9_BAX-05      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggg
G3RTU9_BAX-02      --------------------------tttcatccaggatcgagcagggcgaatggggggg
G3RTU9_BAX-03      -------------ttctgcaccctcactccatccccactcta----ggcgaatggggggg
G3RTU9_BAX-01      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggg
G3RTU9_BAX-04      aagacaggggcccttttgcttcagg-----------------------------------

G3RTU9_BAX-05      gaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagc
G3RTU9_BAX-02      gaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagc
G3RTU9_BAX-03      gaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagc
G3RTU9_BAX-01      gaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagc
G3RTU9_BAX-04      ------------------------------------------------------------

G3RTU9_BAX-05      gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
G3RTU9_BAX-02      gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
G3RTU9_BAX-03      gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
G3RTU9_BAX-01      gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
G3RTU9_BAX-04      ----------------------------------------------------ggatgatt

G3RTU9_BAX-05      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
G3RTU9_BAX-02      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
G3RTU9_BAX-03      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
G3RTU9_BAX-01      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
G3RTU9_BAX-04      gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt

G3RTU9_BAX-05      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
G3RTU9_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
G3RTU9_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
G3RTU9_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
G3RTU9_BAX-04      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg

G3RTU9_BAX-05      gtactcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacg
G3RTU9_BAX-02      gtactcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacg
G3RTU9_BAX-03      gtactcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacg
G3RTU9_BAX-01      gtactcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacg
G3RTU9_BAX-04      gtactcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacg

G3RTU9_BAX-05      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtg---
G3RTU9_BAX-02      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggggctg
G3RTU9_BAX-03      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttg-------
G3RTU9_BAX-01      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttg-------
G3RTU9_BAX-04      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttg-------

G3RTU9_BAX-05      ------------------------------------------agactcctcaagcctcct
G3RTU9_BAX-02      cccctggccgagtcactgaagcgactgatgtccctgtctccaggac------ggcctcct
G3RTU9_BAX-03      ------------------------------------------ggac------ggcctcct
G3RTU9_BAX-01      ------------------------------------------ggac------ggcctcct
G3RTU9_BAX-04      ------------------------------------------ggac------ggcctcct
                                                              ***       *******

G3RTU9_BAX-05      cacccccaccaccacgccctcaccactgcccctgccccaccgtcccttccccccgccact
G3RTU9_BAX-02      ctcctactttgggacgcccacgtggcagaccgtg--------------------accatc
G3RTU9_BAX-03      ctcctactttgggacgcccacgtggcagaccgtg--------------------accatc
G3RTU9_BAX-01      ctcctactttgggacgcccacgtggcagaccgtg--------------------accatc
G3RTU9_BAX-04      ctcctactttgggacgcccacgtggcagaccgtg--------------------accatc
                   * **  *      ****** *    * * ** **                     ***  

G3RTU9_BAX-05      cctctgggaccctgggccttctggagcaggtcacagtggtgccctctccccatcttcaga
G3RTU9_BAX-02      tttgtgg-------------cgggagt-gctcaccgc----ctcactcaccatctgga--
G3RTU9_BAX-03      tttgtgg-------------cgggagt-gctcaccgc----ctcactcaccatctgga--
G3RTU9_BAX-01      tttgtgg-------------cgggagt-gctcaccgc----ctcactcaccatctgga--
G3RTU9_BAX-04      tttgtgg-------------cgggagt-gctcaccgc----ctcactcaccatctgga--
                     * ***             * ****  * **** *     * * *** ******  *  

G3RTU9_BAX-05      tcatcagatgtggtctataatgcgtttttacgtgtctga---------------------
G3RTU9_BAX-02      --agaagatg-----------------------ggctgaggcccccagctgccttggact
G3RTU9_BAX-03      --agaagatg-----------------------ggctga---------------------
G3RTU9_BAX-01      --agaagatg-----------------------ggctga---------------------
G3RTU9_BAX-04      --agaagatg-----------------------ggctga---------------------
                     *  *****                       * ****                     

G3RTU9_BAX-05      -----------------
G3RTU9_BAX-02      gtgtttttcctccataa
G3RTU9_BAX-03      -----------------
G3RTU9_BAX-01      -----------------
G3RTU9_BAX-04      -----------------

© 1998-2019