Dataset for CDS BAK1 of Organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I2Y8H5_BAK1-01      atggcatcggggcaaggcccagggcctcccaggcaggagtgcggaaagcc
G3RSX3_BAK1-02          atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
G3RSX3_BAK1-01          atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
G3RSX3_BAK1-03          atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
                        ***** ***************** ********************* ****

A0A2I2Y8H5_BAK1-01      tgccctgcgctctgcttctgaggagcaggtagcccaggacacggagg-gg
G3RSX3_BAK1-02          tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
G3RSX3_BAK1-01          tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
G3RSX3_BAK1-03          tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
                        ******** ********************************* **** **

A0A2I2Y8H5_BAK1-01      ttttccgcagctaca-----------------------------------
G3RSX3_BAK1-02          ttttccgcagctacgttttttaccgccatcagcagaacc-----------
G3RSX3_BAK1-01          ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
G3RSX3_BAK1-03          ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa

A0A2I2Y8H5_BAK1-01      --gatggcaccctgcgcc---------------------------tccaa
G3RSX3_BAK1-02          ----------cctctgccatgagcca------------------------
G3RSX3_BAK1-01          ggggcggctgcccctgcc--gacccagagatggtcacgttacctctgcaa
G3RSX3_BAK1-03          ggggcggctgcccctgcc--gacccagagatggtcacgttacctctgcaa
                                  **   ***                                

A0A2I2Y8H5_BAK1-01      cctagaagcaccatggggcaggtgggacggcagctcgccatcacc-agga
G3RSX3_BAK1-02          --------------gggcctggtgggacggcagctcgccatcatcgggga
G3RSX3_BAK1-01          cctagcagcaccatggggcaggtgggacggcagctcgccatcatcgggga
G3RSX3_BAK1-03          cctagcagcaccatggggcaggtgggacggcagctcgccatcatcgggga
                                      *** * *********************** *  ***

A0A2I2Y8H5_BAK1-01      cgacatcaaccggcactatgacttcggagttccagaccatgctgcagcgt
G3RSX3_BAK1-02          cgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagcac
G3RSX3_BAK1-01          cgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagcac
G3RSX3_BAK1-03          cgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagcac
                        ************ * ******* ** *************** ******  

A0A2I2Y8H5_BAK1-01      ctgcagcccagggcagagaacgcctacgagtacttcaccaagatcgcctc
G3RSX3_BAK1-02          ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccac
G3RSX3_BAK1-01          ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccac
G3RSX3_BAK1-03          ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccac
                        ********** ********* ***** ***************** *** *

A0A2I2Y8H5_BAK1-01      --------------------cagcctgtttgagagtggcatcaaccgggg
G3RSX3_BAK1-02          --------------------cagcctgtttgagagtggcatcaattgggg
G3RSX3_BAK1-01          --------------------cagcctgtttgagagtggcatcaattgggg
G3RSX3_BAK1-03          caggccagcagcaacacccacagcctgtttgagagtggcatcaattgggg
                                            ************************  ****

A0A2I2Y8H5_BAK1-01      ccgtgtggtggctctcctgggcttcggctaccgtctggtcttacacgtct
G3RSX3_BAK1-02          ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgttt
G3RSX3_BAK1-01          ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgttt
G3RSX3_BAK1-03          ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgttt
                        *************** ********************** * ******* *

A0A2I2Y8H5_BAK1-01      accagcacagcctgactggcttcctgggcctggtgacccgcttcgtggt-
G3RSX3_BAK1-02          accagcatggcctgactggcttcctaggccaggtgacccgcttcgtggtt
G3RSX3_BAK1-01          accagcatggcctgactggcttcctaggccaggtgacccgcttcgtggtt
G3RSX3_BAK1-03          accagcatggcctga-----------------------------------
                        *******  ******                                   

A0A2I2Y8H5_BAK1-01      --cttcatgctgcaacacggcattgcccggtggatctcgcagaggggcgg
G3RSX3_BAK1-02          gacttcatgctgcatcactgcattgcccggtggattgcacagaggggtgg
G3RSX3_BAK1-01          gacttcatgctgcatcactgcattgcccggtggattgcacagaggggtgg
G3RSX3_BAK1-03          --------------------------------------------------

A0A2I2Y8H5_BAK1-01      ctgggtggcagccccggacttgggcaatagtcccatcctgaacgtgctgg
G3RSX3_BAK1-02          ctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
G3RSX3_BAK1-01          ctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
G3RSX3_BAK1-03          --------------------------------------------------

A0A2I2Y8H5_BAK1-01      tggttgtgggtggggttctgctgggccagtttgtggtaagaagattcttc
G3RSX3_BAK1-02          tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttc
G3RSX3_BAK1-01          tggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttc
G3RSX3_BAK1-03          --------------------------------------------------

A0A2I2Y8H5_BAK1-01      aaatcatga
G3RSX3_BAK1-02          aaatcatga
G3RSX3_BAK1-01          aaatcatga
G3RSX3_BAK1-03          ---------

© 1998-2019