Dataset for CDS BAX-like of Organism Gasterosteus aculeatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3PKC3_BOK-01      atgga----ggtcctgcggcggccgtccgtgatggctgctgaggtcctg-----------
G3NL80_BOK-02      atgga----catgttgcgccgctcgtctgtgttcgcggccgaa-----------------
G3NL80_BOK-03      atgga----catgttgcgccgctcgtctgtgttcgcggccgaa-----------------
G3NL80_BOK-01      ------------------------------------------------------------
G3PMZ5_BAX-01      atggc------cgacggcgggagagaaaagcaagacgacggagaccgggaacctcggggc
G3PM69_BAX-02      ------------------------------------aacaaagaccaga-----------
G3PM69_BAX-01      atggcatcgcaccccggaggaggcgatcaaggcaataacaaagaccaga-----------

G3PKC3_BOK-01      -----------------gatgtgtttgaccgatcgctgacggaga---------------
G3NL80_BOK-02      --------------------gtgtttgaccgctcgcccaccgaca---------------
G3NL80_BOK-03      --------------------gtgtttgaccgctcgcccaccgaca---------------
G3NL80_BOK-01      ------------------------------------------------------------
G3PMZ5_BAX-01      gccgagggcggggaa--gatgtggtcgatgatcccatcatggagcaaggagcagtggttc
G3PM69_BAX-02      tcctggaactaggaactgttttgctgaaggatttcatcttcgagc---------------
G3PM69_BAX-01      tcctggaactaggaactgttttgctgaaggatttcatcttcgagc---------------

G3PKC3_BOK-01      ----aggagctggtgtcccagtctaaagccctgtgcagggactacatactgtctagactc
G3NL80_BOK-02      ----aggagctggtgtcccaggccaaggcgctgtgccgggactacattcactccaggctc
G3NL80_BOK-03      ----aggagctggtgtcccaggccaaggcgctgtgccgggactacattcactccaggctc
G3NL80_BOK-01      ------------------------------------------------------------
G3PMZ5_BAX-01      tcagagggtacgtggtgtcacgtataaacgcag----aagacccca--------------
G3PM69_BAX-02      ----gggttaagcg-------gcatggagacagcaccgagactgtg--------------
G3PM69_BAX-01      ----gggttaagcg-------gcatggagacagcaccgagactgtg--------------

G3PKC3_BOK-01      caccagaatg------------gacagggatggtccaagactgaactccacctctctccc
G3NL80_BOK-02      aaccgcgccg------------ggatgggctggtcgaagcccgagtccgggcgcgccgca
G3NL80_BOK-03      aaccgcgccg------------ggatgggctggtcgaagcccgagtccgggcgcgccgca
G3NL80_BOK-01      ------------------------------------------------------------
G3PMZ5_BAX-01      -gtcggcacgtgtcgcctgaacaactgggaggacgcccgaatgaacatcag-gatccgca
G3PM69_BAX-02      -accaggacg-----------cagctgggtg-------gagtggagctgagcgacccgaa
G3PM69_BAX-01      -accaggacg-----------cagctgggtg-------gagtggagctgagcgacccgaa

G3PKC3_BOK-01      tcaagtgcagcgctcgccgaggtgtctttggtgctcctctgccttggcgacgagctggag
G3NL80_BOK-02      ccgggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggag
G3NL80_BOK-03      ccgggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggag
G3NL80_BOK-01      -------------------atgtct--------------tggccaggtgatgagttggag
G3PMZ5_BAX-01      a-----------atcaaagaagtggtgaagcagctaatgaagattgcagatgagatga--
G3PM69_BAX-02      c-----------cacaagaagctggccatgtgcctgcagcagatcggagacgagttgg--
G3PM69_BAX-01      c-----------cacaagaagctggccatgtgcctgcagcagatcggagacgagttgg--
                                      *  *                      *  ** *** **   

G3PKC3_BOK-01      tccatacggcccagtttgtacaggaacgtggcgcggcagctcaacatctctgttgccatg
G3NL80_BOK-02      taccttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcg
G3NL80_BOK-03      taccttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcg
G3NL80_BOK-01      taccttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcg
G3PMZ5_BAX-01      -------------------acaggaacgccgagctccaacgactgatcagccaggttccg
G3PM69_BAX-02      -------------------acggaaacgtagagcttcaaagaatgatgaacgactcttcg
G3PM69_BAX-01      -------------------acggaaacgtagagcttcaaagaatgatgaacgactcttcg
                                      ** * ****  * **  **       **            *

G3PKC3_BOK-01      gagaacatggtttcagatgccttcatcggcgtggcaacggagatcttctcaacaggga--
G3NL80_BOK-02      gagagcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtg--
G3NL80_BOK-03      gagagcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtg--
G3NL80_BOK-01      gagagcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtg--
G3PMZ5_BAX-01      ggcaactgtgctcaggacatcttcatgaaggtcgccaaaagcatcttcgacgatggca--
G3PM69_BAX-02      ctcggtcccacaaaagatgtgtttttgaaagttgccttcgagatcttttcggatggaaaa
G3PM69_BAX-01      ctcggtcccacaaaagatgtgtttttgaaagttgccttcgagatcttttcggatggaaaa
                                  **    **  *    ** **       ** **       **    

G3PKC3_BOK-01      -tcacatggggaaaggtggtgtccatgtatgcagtagccggagccctggcggtggact--
G3NL80_BOK-02      -tgacatgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtggact--
G3NL80_BOK-03      -tgacatgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtggact--
G3NL80_BOK-01      -tgacatgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtggact--
G3PMZ5_BAX-01      -tcaactggggtcgagtggtggctctgttccatctggc-----------ctaccggctca
G3PM69_BAX-02      ttcaactggggccgggtggtcgcactgttctactttgc-----------ctgtcgactcg
G3PM69_BAX-01      ttcaactggggccgggtggtcgcactgttctactttgc-----------ctgtcgactcg
                    * *  *****    *****  *  ***      * **           *    * **  

G3PKC3_BOK-01      --------gtgtccgtca-gggccacccagccaccgttcacatcttggtggccagtctgg
G3NL80_BOK-02      --------gcgttcgcca-cggccacccagctattgtccataccattgtcgactgcatgg
G3NL80_BOK-03      --------gcgttcgcca-cggccacccagctattgtccataccattgtcgactgcatgg
G3NL80_BOK-01      --------gcgttcgcca-cggccacccagctattgtccataccattgtcgactgcatgg
G3PMZ5_BAX-01      tatacagggcactgaccaccaaccacctcgagaacatcaggataataatcggctgggttc
G3PM69_BAX-02      tcatcaaagctcttgtgaccaaagttcctgacataatccgaacgataatcagctggacca
G3PM69_BAX-01      tcatcaaagctcttgtgaccaaagttcctgacataatccgaacgataatcagctggacca
                           *        *        *  *  *   *    *   *  *   * *     

G3PKC3_BOK-01      gacagtttgtccgcaagtttctggtcccctggctgaagagacggggaggatgggcggaga
G3NL80_BOK-02      gggagtttgtccgcaagagcctgaccacctggctgaaaaggagagggggctgggtggatg
G3NL80_BOK-03      gggagtttgtccgcaagagcctgaccacctggctgaaaaggagagggggctgggtggatg
G3NL80_BOK-01      gggagtttgtccgcaagagcctgaccacctggctgaaaaggagagggggctgggtggatg
G3PMZ5_BAX-01      tgcggttcatcagggagcgactctacccctggctcgtgcagcagggcggctgggtgggcg
G3PM69_BAX-02      tggactacctccgcgaacatgtgatcaactggatcagggagcaaggtggctgggagggca
G3PM69_BAX-01      tggactacctccgcgaacatgtgatcaactggatcagggagcaaggtggctgggagggca
                        *   ** *  *     *   *  **** *          ** ** **** **   

G3PKC3_BOK-01      tgtgtaaatgtgtgttgaagaaggatcttcccccggagcaccac--tggctgtcgtctgc
G3NL80_BOK-02      ttacgaaatgcgtggtgaacacagaccccagcttccgctctcac--tggctggtgtcggc
G3NL80_BOK-03      ttacgaaatgcgtggtgaacacagaccccagcttccgctctcac--tggctggtgtcggc
G3NL80_BOK-01      ttacgaaatgcgtggtgaacacagaccccagcttccgctctcac--tggctggtgtcggc
G3PMZ5_BAX-01      t----------------------gatcaa----cgggttttctcgatggaggaatgtggc
G3PM69_BAX-02      ttc--------------------gctcccacctcggcacacccacatggcagacggtg--
G3PM69_BAX-01      ttc--------------------gctcccacctcggcacacccacatggcagacggtg--
                   *                      *  *              *    ***  *        

G3PKC3_BOK-01      aatggattccctgaaatacttcct------caccgcgctgtacgtctgcgtcatgaagga
G3NL80_BOK-02      cgtctgtgccttcggacactatctgaaggccactgtgttgtacctcctc------agaga
G3NL80_BOK-03      cgtctgtgccttcggacactatctgaaggccactgtgttgtacctcctc------agaga
G3NL80_BOK-01      cgtctgtgccttcggacactatctgaaggccactgtgttgtacctcctc------agaga
G3PMZ5_BAX-01      catcgtagcatcggtagcattggtggtagctcttgttt---actaccgg------aagac
G3PM69_BAX-02      ----ggagttttcttggccggggtcctcactaccgttttagtcattcgc------aagat
G3PM69_BAX-01      ----ggagttttcttggccggggtcctcactaccgttttagtcattcgc------aagat
                                          *          *       *            *    

G3PKC3_BOK-01      gccgtga
G3NL80_BOK-02      cacgtga
G3NL80_BOK-03      cacgtga
G3NL80_BOK-01      cacgtga
G3PMZ5_BAX-01      g---cgc
G3PM69_BAX-02      ggttgga
G3PM69_BAX-01      g---tga

© 1998-2019