Dataset for CDS BAX of Organism Gasterosteus aculeatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3PMZ5_BAX-01      atggc------cgacggcgggagagaaaagcaagacgacggagaccgggaacctcggggc
G3PM69_BAX-02      ------------------------------------aacaaagaccaga-----------
G3PM69_BAX-01      atggcatcgcaccccggaggaggcgatcaaggcaataacaaagaccaga-----------
                                                        **  ***** *            

G3PMZ5_BAX-01      gccgagggcggggaa--gatgtggtcgatgatcccatcatggagcaaggagcagtggttc
G3PM69_BAX-02      tcctggaactaggaactgttttgctgaaggatttcatcttcgagc---------------
G3PM69_BAX-01      tcctggaactaggaactgttttgctgaaggatttcatcttcgagc---------------
                    **  *  *  ****  * * ** *  * ***  **** * ****               

G3PMZ5_BAX-01      tcagagggtacgtggtgtcacgtataaacgcag----aagaccccagtcggcacgtgtcg
G3PM69_BAX-02      ----gggttaagcg-------gcatggagacagcaccgagactgtgaccaggacg-----
G3PM69_BAX-01      ----gggttaagcg-------gcatggagacagcaccgagactgtgaccaggacg-----
                        ** ** * *       * **  *  ***     ****      * * ***     

G3PMZ5_BAX-01      cctgaacaactgggaggacgcccgaatgaacatcag-gatccgcaaatcaaagaagtggt
G3PM69_BAX-02      ------cagctgggtg-------gagtggagctgagcgacccgaaccacaagaagctggc
G3PM69_BAX-01      ------cagctgggtg-------gagtggagctgagcgacccgaaccacaagaagctggc
                         ** ***** *       ** ** *  * ** ** *** *   ***  *  *** 

G3PMZ5_BAX-01      gaagcagctaatgaagattgcagatgagatgaacaggaacgccgagctccaacgactgat
G3PM69_BAX-02      catgtgcctgcagcagatcggagacgagttggacggaaacgtagagcttcaaagaatgat
G3PM69_BAX-01      catgtgcctgcagcagatcggagacgagttggacggaaacgtagagcttcaaagaatgat
                    * *   **   * **** * *** *** ** ** * ****  ***** *** ** ****

G3PMZ5_BAX-01      cagccaggttccgggcaactgtgctcaggacatcttcatgaaggtcgccaaaagcatctt
G3PM69_BAX-02      gaacgactcttcgctcggtcccacaaaagatgtgtttttgaaagttgccttcgagatctt
G3PM69_BAX-01      gaacgactcttcgctcggtcccacaaaagatgtgtttttgaaagttgccttcgagatctt
                    * * *   * **  *       *  * **  * **  **** ** ***      *****

G3PMZ5_BAX-01      cgacgatggca---tcaactggggtcgagtggtggctctgttccatctggcctaccggct
G3PM69_BAX-02      ttcggatggaaaattcaactggggccgggtggtcgcactgttctactttgcctgtcgact
G3PM69_BAX-01      ttcggatggaaaattcaactggggccgggtggtcgcactgttctactttgcctgtcgact
                       ***** *   ********** ** ***** ** ****** *  * ****  ** **

G3PMZ5_BAX-01      catatacagggcactgaccaccaaccacctcgagaacatcaggataataatcggctgggt
G3PM69_BAX-02      cgtcatcaaagctcttgtgaccaaagttcctgacataatccgaacgataatcagctggac
G3PM69_BAX-01      cgtcatcaaagctcttgtgaccaaagttcctgacataatccgaacgataatcagctggac
                   * *   **  ** **    *****    *  ** *  *** * *  ****** *****  

G3PMZ5_BAX-01      tctgcggttcatcagggagcgactctacccctggctcgtgcagcagggcggctgggtggg
G3PM69_BAX-02      catggactacctccgcgaacatgtgatcaactggatcagggagcaaggtggctgggaggg
G3PM69_BAX-01      catggactacctccgcgaacatgtgatcaactggatcagggagcaaggtggctgggaggg
                     **   * * ** * ** *   *   *  **** **  * **** ** ******* ***

G3PMZ5_BAX-01      cgt--gatcaa----cgggttttctcgatggaggaatgtggccatcgtagcatcggtagc
G3PM69_BAX-02      cattcgctcccacctcggcacacccacatggcagacggtg------ggagttttcttggc
G3PM69_BAX-01      cattcgctcccacctcggcacacccacatggcagacggtg------ggagttttcttggc
                   * *  * **      ***     *   ****  **  ***      * **  *   * **

G3PMZ5_BAX-01      attggtggtagctcttgttt---actaccggaagacg---cgc
G3PM69_BAX-02      cggggtcctcactaccgttttagtcattcgcaagatggttgga
G3PM69_BAX-01      cggggtcctcactaccgttttagtcattcgcaagatg---tga
                      ***  *  **   ****    *   ** **** *    * 

© 1998-2018