Dataset for CDS BOK of Organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F1N8M0_BOK-01      atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggaggtgttcgacagg
Q9I8I2_BOK-01      atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggaggtgttcgacagg
                   ************************************************************

F1N8M0_BOK-01      tctcccactgacaaggagcttgtgtcccaagccaaggctctctgcagggactacatcaac
Q9I8I2_BOK-01      tctcccactgacaaggagcttgtgtcccaagccaaggctctctgcagggactacatcaac
                   ************************************************************

F1N8M0_BOK-01      tccaggctgatccgtgcaggcgtcagctggagcaaacctgagcacaataccccggtgcct
Q9I8I2_BOK-01      tccaggctgatccgtgcaggcgtcagctggagcaaacctgagcacaataccccggtgcct
                   ************************************************************

F1N8M0_BOK-01      ggaggcaagctggctgaggtgtctgccatcctgctgtgcctgggggatgagctggaatac
Q9I8I2_BOK-01      ggaggcaagctggctgaggtgtctgccatcctgctgcgcctgggggatgagctggaatac
                   ************************************ ***********************

F1N8M0_BOK-01      attcgccccaacgtctaccgcaacatcgcccgccagctgaacatctcgctgcactcggag
Q9I8I2_BOK-01      attcgccccaacgtctaccgcaacatcgcccgccagctgaacatctcgctgcactcggag
                   ************************************************************

F1N8M0_BOK-01      acggtggtgacggatgctttcctggccgtggctgcgcagatcttcactgcaggcataaca
Q9I8I2_BOK-01      acggtggtgacggatgctttcctggccgtggctgcgcagatcttcactgcaggcataaca
                   ************************************************************

F1N8M0_BOK-01      tggggcaaggtggtgtctctctatgccgtggcagcggggctggcagtggactgcgtgcgg
Q9I8I2_BOK-01      tggggcaaggtggtgtctctctatgccgtggcagcggggctggcagtggactgcgtgcgg
                   ************************************************************

F1N8M0_BOK-01      cacgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaag
Q9I8I2_BOK-01      cacgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaag
                   ************************************************************

F1N8M0_BOK-01      accttggtgacgtggctgaagaggcgaggaggctg----gacatcaccaagtgcgtggtg
Q9I8I2_BOK-01      accttggtgacgtggctgaagaggcgaggaggctgggcagacatcaccaagtgcgtggtg
                   ***********************************    *********************

F1N8M0_BOK-01      a-----------------------------------------------------------
Q9I8I2_BOK-01      agcaccgaccccagtctccgttcccactggctcgtggccgccgtctgcagctttgggcac
                   *                                                           

F1N8M0_BOK-01      ------------------------------------------
Q9I8I2_BOK-01      ttcctcaaggccatcttctttgtgctgctgcccgagagatga
                                                             

© 1998-2018