Dataset for CDS BAX-like of Organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q5F404_BAK1-01      atggaaggga-acgagggggacccacccggggcccacagacgccgggacagccatgggcg
F1N8M0_BOK-01       atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggag-----gtgttcg
Q9I8I2_BOK-01       atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggag-----gtgttcg
                    ******* *   **  *     **  *   *   ** **  *  **        **  **

Q5F404_BAK1-01      -caggccatcacgagagatcaatgcagaggaccaggtggcccaggagaccgaggaggtgt
F1N8M0_BOK-01       acaggtctcc---------cactgacaaggagcttgtgtcccaag---ccaaggctctct
Q9I8I2_BOK-01       acaggtctcc---------cactgacaaggagcttgtgtcccaag---ccaaggctctct
                     **** *  *         ** **   **** *  *** **** *   ** ***   * *

Q5F404_BAK1-01      tccggagctacaccttct----accgctaccaacagg----agagagaggagggaggggc
F1N8M0_BOK-01       gcagggactacatcaactccaggctgatccgtgcaggcgtcagctggagcaaacctgagc
Q9I8I2_BOK-01       gcagggactacatcaactccaggctgatccgtgcaggcgtcagctggagcaaacctgagc
                     * **  ***** *  **     * * * *   ****    **   *** *     * **

Q5F404_BAK1-01      ggaggtgcccatggacccggagatcatggagatccagc--aggagctgggcagcaccggg
F1N8M0_BOK-01       aca-ataccccggtgcctgga------ggcaagctggctgaggtgtctgccatcctgctg
Q9I8I2_BOK-01       aca-ataccccggtgcctgga------ggcaagctggctgaggtgtctgccatcctgctg
                      *  * ***  *  ** ***      **  * *  **  *** *   * ** *     *

Q5F404_BAK1-01      agccaggtgggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcg
F1N8M0_BOK-01       tgcctgggggatgag---ctggaatacattcgccccaacgtctac---cgcaacatcgc-
Q9I8I2_BOK-01       cgcctgggggatgag---ctggaatacattcgccccaacgtctac---cgcaacatcgc-
                     *** ** **    *   ****    ***  *   * ** ** **   **  **  *** 

Q5F404_BAK1-01      gagttccgccatatgctgaagtccttgcagcccaccaaggagaacgcctacgagtacttc
F1N8M0_BOK-01       -----ccgcca---gctgaacatctcgctgcac-tcggagacggtggtgacggatgcttt
Q9I8I2_BOK-01       -----ccgcca---gctgaacatctcgctgcac-tcggagacggtggtgacggatgcttt
                         ******   ******   ** ** ** *  *   **    *   ***  * *** 

Q5F404_BAK1-01      acc-accatcgcctccagcttgttcgacagcggcattaactggggccgggtgattgccct
F1N8M0_BOK-01       cctggccgtggctgcgcagatcttcactgcaggcataacatggggcaaggtggtgtctct
Q9I8I2_BOK-01       cctggccgtggctgcgcagatcttcactgcaggcataacatggggcaaggtggtgtctct
                     *   ** * **  *     * ***      ***** *  ******  **** *  * **

Q5F404_BAK1-01      gctgggtttcggttactgcatggccatccacgtctaccagcaaggc--atcacgggcttc
F1N8M0_BOK-01       ------------ctatgccgtgg--------------cagcggggctggcagtggactgc
Q9I8I2_BOK-01       ------------ctatgccgtgg--------------cagcggggctggcagtggactgc
                                 **   * ***              ****  ***       ** ** *

Q5F404_BAK1-01      ctgcg--ccgcatcgcccgctacgtcaccgaattcatgctgcgcaaccgcatcgcacggt
F1N8M0_BOK-01       gtgcggcacgcacagccagccatg-------gtccacac---------------catcgt
Q9I8I2_BOK-01       gtgcggcacgcacagccagccatg-------gtccacac---------------catcgt
                     ****   ****  *** ** * *        * **  *               **  **

Q5F404_BAK1-01      ggatcgcccagcagggaggatgggtggctgcactcgatctggacaatgtttacatgaagt
F1N8M0_BOK-01       ggactgcct----gggagagt--ttgtccgca--------agaccttggtgacgtg----
Q9I8I2_BOK-01       ggactgcct----gggagagt--ttgtccgca--------agaccttggtgacgtg----
                    ***  ***     *****  *   ** * ***         ***  ** * ** **    

Q5F404_BAK1-01      acatgctggtggtgctggccctggtgatggtggggcat-------ttagtggtac-----
F1N8M0_BOK-01       ----gctgaagaggcgag----gaggctg----gacatcaccaagtgcgtggtga-----
Q9I8I2_BOK-01       ----gctgaagaggcgag----gaggctgggcagacatcaccaagtgcgtggtgagcacc
                        ****  *  **  *    *  * **    * ***       *  *****       

Q5F404_BAK1-01      -------------------------------------------------gacgcttcttc
F1N8M0_BOK-01       ------------------------------------------------------------
Q9I8I2_BOK-01       gaccccagtctccgttcccactggctcgtggccgccgtctgcagctttgggcacttcctc
                                                                                

Q5F404_BAK1-01      aggccc---------------------------tga
F1N8M0_BOK-01       ------------------------------------
Q9I8I2_BOK-01       aaggccatcttctttgtgctgctgcccgagagatga
                                                        

© 1998-2018