Dataset for CDS BAX-like of Organism Ficedula albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U3JLA0_BOK-01       atg----------------gaggtgctgcgccgct------------------cctcagt
U3JMQ7_BAK1-01      atggcctcggggaatgagggggaccctccacagctggaggaacgccgggggagccacagg
U3K1D1_BAX-01       -------------------gagccccagcccagcagcccggacaccaag-----------
                                       * *   *  * * **                          

U3JLA0_BOK-01       ctttgctgcaga-----------ggtgatggaggtttttgacaggtctcccactgacaaa
U3JMQ7_BAK1-01      cgccggctcagctcagagggccgggtggcggaggaggctgaggaggtgttcaggagctac
U3K1D1_BAX-01       ---cgcctcagc---gagtgcc-tgcggcg--------------------catcggcgac
                        *   ***             * *  *                    **    * * 

U3JLA0_BOK-01       gagcttgtgtcccaagccaaggctctctgcagagactacataaactcaaggctga---tt
U3JMQ7_BAK1-01      gcctt-----------ccaccgctaccagcaggagcgccaggagcgaggggcagagctgc
U3K1D1_BAX-01       gagct-----------cgacagcaacatg-gggggccccaggat----------------
                    *   *           * *  **     *  *   *  **  *                 

U3JLA0_BOK-01       caggcaggtgtcagctggagcaaacccgagcacaacgccccagtgcctgggggcaagctg
U3JMQ7_BAK1-01      cgcccgaccccgagatcgagcaaatccagcaggacctggacagcaccggcagccaggtgg
U3K1D1_BAX-01       -------------gatcgag---------------------------------caggtgg
                                 * * ***                                 ** *  *

U3JLA0_BOK-01       ---------------------------------------gccgaggtgtc--------ca
U3JMQ7_BAK1-01      ggcagcgcttggccatcatcggcgatgacatctaccggcgctacgacgccgagttccgca
U3K1D1_BAX-01       ---------------------------------------gctgtgacgcc----------
                                                           **   *  * *          

U3JLA0_BOK-01       ccatactgctgagacttggggatgagctggagtacattcgccccaacgtctacaggaaca
U3JMQ7_BAK1-01      ccatgctggagagc------------ctgcagcccacccgcgacaacgcctacgagaact
U3K1D1_BAX-01       ----cccaaaaagc------------t----gtttttccgcg---tggccaaggagatgt
                         *     **                  *      ***      * * *   **   

U3JLA0_BOK-01       tcgcccgccagctgaacatctctctgcactctgagaccgtggtgtctgacgccttcctgg
U3JMQ7_BAK1-01      tcaccaaa------atcgcctccagcctgtttgagagc----------------------
U3K1D1_BAX-01       tcgccgac------ggcacct---------------------------------------
                    ** **           *  **                                       

U3JLA0_BOK-01       cagtggctgcacagattttcactgcagcaggcataacgtggggcaaggtggtgtctctgt
U3JMQ7_BAK1-01      -----------------------------ggcatcaactggggccgggtgatcgccctgc
U3K1D1_BAX-01       ---------------------------------tcaactggggccgcgtagtcgccctgt
                                                     * *  ******   **  *  * *** 

U3JLA0_BOK-01       acgccgtggcagccgggctggccgtggactgcgtgcggcacgcgcagccagccatggttc
U3JMQ7_BAK1-01      tggcctttggctaccgcctggccatgcacgtgtggcagcgcggggtcagcggcttcctgc
U3K1D1_BAX-01       tctactttgcctgcaagctgg---------------------------------------
                        * * *    *   ****                                       

U3JLA0_BOK-01       acaccatcgtggactgcctgggagagtttgtgaggaagac------------cttggtga
U3JMQ7_BAK1-01      ggcgcatcgcgcagcacctggcgcagttcatgctgcagaaccgcatcgcccgctggatcg
U3K1D1_BAX-01       ------------------------------tgctgaag----------------------
                                                  **  * **                      

U3JLA0_BOK-01       cgtggctgaaaaggagaggag----gctgggcagacatcaccaagtgcgtggtgaata-c
U3JMQ7_BAK1-01      cccagcagggaggatggagggccgcgctgcgccgctacaacgaagtttacatcaagtacc
U3K1D1_BAX-01       ------------------------------------------------------------

U3JLA0_BOK-01       tgaccccagccttcgctcccactggctcgtggctgctgtttgcagttttggt-------c
U3JMQ7_BAK1-01      tgctggtggccgccgc---------------ggtgctgctggcacacctggcggtgcggc
U3K1D1_BAX-01       ------------------------------------------------------------

U3JLA0_BOK-01       acttcctcaaggccatcttctttgtcctgctgcctgagagatga
U3JMQ7_BAK1-01      gcttcctcacctcc---------------------------tga
U3K1D1_BAX-01       --------------------------------------------

© 1998-2019