Dataset for CDS BAX-like of Organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M3WKE8_BOK-01           atgga--ggtgctgcggcgctcctcggtcttcgccgccgagatcatggac
Q8SQ43_BAX-01           atggacgggtccggggagcagcccag--------aggcggggg-------
A0A337S002_BAX-02       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A337S002_BAX-01       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A337S002_BAX-03       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2I2UUV3_BAK1-02      atggc---atccgggcaa-ggcccaggtcctcccaggcaggagtgtgaag
A0A2I2UUV3_BAK1-01      atggc---atccgggcaa-ggcccaggtcctcccaggcaggagtgtgaag
                        ****     * * *       **  *         * *  *         

M3WKE8_BOK-01           gcctttgaccgctcgcccaccgacaag--gagctggtggcccaggccaag
Q8SQ43_BAX-01           ----------gcaca-ccagctctgagcagatcatgaagacaggggccct
A0A337S002_BAX-02       -----------------------tgag-----------------------
A0A337S002_BAX-01       ----------gccca-ccagctctgagcagatcatgaagacaggggccct
A0A337S002_BAX-03       ----------gccca-ccagctctgagcagatcatgaagacaggggccct
A0A2I2UUV3_BAK1-02      agactgccccgtctg-ctacttctgag--gagcaggtagcccgggacacc
A0A2I2UUV3_BAK1-01      agactgccccgtctg-ctacttctgag--gagcaggtagcccgggacacc

M3WKE8_BOK-01           gcg---------ctcggccgggagttcgtgcatgcgcgactgctgcgc--
Q8SQ43_BAX-01           -------tttgcttcag----ggtttcatccaagatc-----gagcaggg
A0A337S002_BAX-02       -----------------------tttcatccaagatc-----gagcag--
A0A337S002_BAX-01       -------tttgcttcag----ggtttcatccaagatc-----gagcaggg
A0A337S002_BAX-03       -------tttgcttcag----g----------------------------
A0A2I2UUV3_BAK1-02      gaggaggttttccgcagctatgtttttcaccgttatcagcaggagcag-g
A0A2I2UUV3_BAK1-01      gaggaggttttccgcagctatgtttttcaccgttatcagcaggagcag-g

M3WKE8_BOK-01           ----------gccggcctcgcctggaacgcgcccgaacgcgccgctcccg
Q8SQ43_BAX-01           cgaatggggggagagacgcccga---gctggccctggagcag-----gtg
A0A337S002_BAX-02       --------------gacgcccga---gctggccctggagcag-----gtg
A0A337S002_BAX-01       cgaatggggggagagacgcccga---gctggccctggagcag-----gtg
A0A337S002_BAX-03       --------------------------------------------------
A0A2I2UUV3_BAK1-02      aggctgagggggcagctgcgcct---actgacccagaaatagtcaccttg
A0A2I2UUV3_BAK1-01      aggctgagggggcagctgcgcct---actgacccagaaatagtcaccttg

M3WKE8_BOK-01           cccccgga-------ggccgcctggcggaggtgtgcgcggtgctgctgcg
Q8SQ43_BAX-01           ccccagga------cgcgtccaccaagaagctgagcgagtgtctcaagcg
A0A337S002_BAX-02       ccccagga------cgcgtccaccaagaagctgagcgagtgtctcaagcg
A0A337S002_BAX-01       ccccagga------cgcgtccaccaagaagctgagcgagtgtctcaagcg
A0A337S002_BAX-03       --------------------------------------------------
A0A2I2UUV3_BAK1-02      cccctagaacctagcagcaccatggggcaggtgggtcggcagctcgccat
A0A2I2UUV3_BAK1-01      cccctagaacctagcagcaccatggggcaggtgggtcggcagctcgccat

M3WKE8_BOK-01           cctgggagatgagctggagc--tgatccggcccagcatctaccgcaacgt
Q8SQ43_BAX-01           catcggagatga-actggacagtaacatg-----gaattgcagaggat--
A0A337S002_BAX-02       catcggagatga-actggacagtaacatg-----gaattgcagaggat--
A0A337S002_BAX-01       catcggagatga-actggacagtaacatg-----gaattgcagaggat--
A0A337S002_BAX-03       --------------------------------------------ggat--
A0A2I2UUV3_BAK1-02      cattggggacaacatcaaccagcgctacgattcagagttccaggccat--
A0A2I2UUV3_BAK1-01      cattggggacaacatcaaccagcgctacgattcagagttccaggccat--

M3WKE8_BOK-01           ggctcgtcagctgaacatctccctgcagtctgagacagtggtgaccgacg
Q8SQ43_BAX-01           -gatcg-cag------------ctgtggac----acagactccccccgcg
A0A337S002_BAX-02       -gatcg-cag------------ctgtggac----acagactccccccgcg
A0A337S002_BAX-01       -gatcg-cag------------ctgtggac----acagactccccccgcg
A0A337S002_BAX-03       -gatcg-cag------------ctgtggac----acagactccccccgcg
A0A2I2UUV3_BAK1-02      -gct-g-cagcg---------cctgcaacccacagcagagaacgcctatg
A0A2I2UUV3_BAK1-01      -gct-g-cagcg---------cctgcaacccacagcagagaacgcctatg
                         * * * ***            ***    *     ***      **   *

M3WKE8_BOK-01           ccttcctggcc---gtggcagcacaa-----------------atcttct
Q8SQ43_BAX-01           aggtctttttccgagtggcagcggag-----------------atgtttt
A0A337S002_BAX-02       aggtctttttccgagtggcagcggag-----------------atgtttt
A0A337S002_BAX-01       aggtctttttccgagtggcagcggag-----------------atgtttt
A0A337S002_BAX-03       aggtctttttccgagtggcagcggag-----------------atgtttt
A0A2I2UUV3_BAK1-02      aacttttcaccaagattgcctcgaggccagcagcaacacccacagtctat
A0A2I2UUV3_BAK1-01      aacttttcaccaagattgcctcg--------------------agtctat
                           *  *   *    * **  *                     *   * *

M3WKE8_BOK-01           ccgcaggca---tcacgtggggcaaggtggtgtccctgtactcagtggct
Q8SQ43_BAX-01           ccgatggcaacttcaactggggccgggtcgttgccct-----------ct
A0A337S002_BAX-02       ccgatggcaacttcaactggggccgggtcgttgccct-----------ct
A0A337S002_BAX-01       ccgatggcaacttcaactggggccgggtcgttgccct-----------ct
A0A337S002_BAX-03       ccgatggcaacttcaactggggccgggtcgttgccct-----------ct
A0A2I2UUV3_BAK1-02      ttgagagcggcatcaactggggccgagtggtggctct-----------cc
A0A2I2UUV3_BAK1-01      ttgagagcggcatcaactggggccgagtggtggctct-----------cc
                          *   **    ***  ******   ** **  * **           * 

M3WKE8_BOK-01           gcggggctggccgtagactgtgtgcggcaggcccagcccgcca-------
Q8SQ43_BAX-01           tctactttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcc
A0A337S002_BAX-02       tctactttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcc
A0A337S002_BAX-01       tctactttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcc
A0A337S002_BAX-03       tctactttgccagcaaactg-gtgctcaaggccctgtgtaccaaggtgcc
A0A2I2UUV3_BAK1-02      tgggctttggctaccgcctg-gctct-----acacatctacca----gca
A0A2I2UUV3_BAK1-01      tgggctttggctaccgcctg-gctct-----acacatctacca----gca
                               ** *      *** *  *       *       ***       

M3WKE8_BOK-01           -----tggtccacgctatcgtcgactgcctcggggagt------------
Q8SQ43_BAX-01           cgagctgatccggaccatcatgggctggacactggact------------
A0A337S002_BAX-02       cgagctgatccggaccatcatgggctggacactggact------------
A0A337S002_BAX-01       cgagctgatccggaccatcatgggctggacactggact------------
A0A337S002_BAX-03       cgagctgatccggaccatcatgggctggacactggact------------
A0A2I2UUV3_BAK1-02      cggcctga------------------------------------------
A0A2I2UUV3_BAK1-01      cggcctgacc--ggcttcctgggccaggtgaccaaactggtggtcgacgt

M3WKE8_BOK-01           --ttgtgcgcaagaccctggcgccctggctgcggaggcgcggcggatgga
Q8SQ43_BAX-01           --tccttcgagagcggctgctgggctggatccaggaccagggtggttggg
A0A337S002_BAX-02       --tccttcgagagcggctgctgggctggatccaggaccagggtggttggg
A0A337S002_BAX-01       --tccttcgagagcggctgctgggctggatccaggaccagggtggttggg
A0A337S002_BAX-03       --tccttcgagagcggctgctgggctggatccaggaccagggtggttggg
A0A2I2UUV3_BAK1-02      --------------------------------------------------
A0A2I2UUV3_BAK1-01      catgctgcgtcactgcattgcccggtggattgcgcagaggggcggctggg

M3WKE8_BOK-01           ccgatgtcctcaagt--gtgtggtcagcaccgagcccggc--ttccgctc
Q8SQ43_BAX-01           acggcctcctctcctactttgggacacccacgtggcagacagtgaccatc
A0A337S002_BAX-02       acggcctcctctcctactttgggacacccacgtggcagacagtgaccatc
A0A337S002_BAX-01       acggcctcctctcctactttgggacacccacgtggcagacagtgaccatc
A0A337S002_BAX-03       acggcctcctctcctactttgggacacccacgtggcagacagtgaccatc
A0A2I2UUV3_BAK1-02      --------------------------------------------------
A0A2I2UUV3_BAK1-01      tggcagccctgaact--tgggaaatggccccatcgtgaac-gtgctgata

M3WKE8_BOK-01           acactggctggtggccgcactctgcagcttcggccgcttcctgaaggccg
Q8SQ43_BAX-01           tttgtggcgggag-------------------------tgctgactgcgt
A0A337S002_BAX-02       tttgtggccggag-------------------------tgctgactgcgt
A0A337S002_BAX-01       tttgtggccggag-------------------------tgctgactgcgt
A0A337S002_BAX-03       tttgtggccggag-------------------------tgctgactgcgt
A0A2I2UUV3_BAK1-02      --------------------------------------------------
A0A2I2UUV3_BAK1-01      gttctgtctgtgg-------------------------ttctgttgggcc

M3WKE8_BOK-01           ccttcttcgtgctgttgccagagagatga---
Q8SQ43_BAX-01           cactcgccatctggaaaaagatgggctga---
A0A337S002_BAX-02       cactcaccatctggaaaaagatgggctga---
A0A337S002_BAX-01       cactcaccatctggaaaaagatgggctga---
A0A337S002_BAX-03       cactcaccatctggaaaaagatgggctga---
A0A2I2UUV3_BAK1-02      --------------------------------
A0A2I2UUV3_BAK1-01      agtttgtggtacgaagattcttcaaatcatga

© 1998-2019