Dataset for CDS BAX of Organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q8SQ43_BAX-01          atggacgggtccggggagcagcccagaggcggggggcacaccagctctga
A0A337S002_BAX-02      atggacgggtccggggagcagcccagaggcggggg------------tga
A0A337S002_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A337S002_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       ***********************************            ***

Q8SQ43_BAX-01          gcagatcatgaagacaggggcccttttgcttcagggtttcatccaagatc
A0A337S002_BAX-02      g-----------------------------------tttcatccaagatc
A0A337S002_BAX-03      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A337S002_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaagatc

Q8SQ43_BAX-01          gagcagggcgaatggggggagagacgcccgagctggccctggagcaggtg
A0A337S002_BAX-02      gagcag----------------gacgcccgagctggccctggagcaggtg
A0A337S002_BAX-03      --------------------------------------------------
A0A337S002_BAX-01      gagcagggcgaatggggggagagacgcccgagctggccctggagcaggtg

Q8SQ43_BAX-01          ccccaggacgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A337S002_BAX-02      ccccaggacgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A337S002_BAX-03      --------------------------------------------------
A0A337S002_BAX-01      ccccaggacgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg

Q8SQ43_BAX-01          agatgaactggacagtaacatggaattgcagaggatgatcgcagctgtgg
A0A337S002_BAX-02      agatgaactggacagtaacatggaattgcagaggatgatcgcagctgtgg
A0A337S002_BAX-03      --------------------------------ggatgatcgcagctgtgg
A0A337S002_BAX-01      agatgaactggacagtaacatggaattgcagaggatgatcgcagctgtgg

Q8SQ43_BAX-01          acacagactccccccgcgaggtctttttccgagtggcagcggagatgttt
A0A337S002_BAX-02      acacagactccccccgcgaggtctttttccgagtggcagcggagatgttt
A0A337S002_BAX-03      acacagactccccccgcgaggtctttttccgagtggcagcggagatgttt
A0A337S002_BAX-01      acacagactccccccgcgaggtctttttccgagtggcagcggagatgttt

Q8SQ43_BAX-01          tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgc
A0A337S002_BAX-02      tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgc
A0A337S002_BAX-03      tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgc
A0A337S002_BAX-01      tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgc

Q8SQ43_BAX-01          cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc
A0A337S002_BAX-02      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc
A0A337S002_BAX-03      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc
A0A337S002_BAX-01      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc

Q8SQ43_BAX-01          ggaccatcatgggctggacactggacttccttcgagagcggctgctgggc
A0A337S002_BAX-02      ggaccatcatgggctggacactggacttccttcgagagcggctgctgggc
A0A337S002_BAX-03      ggaccatcatgggctggacactggacttccttcgagagcggctgctgggc
A0A337S002_BAX-01      ggaccatcatgggctggacactggacttccttcgagagcggctgctgggc

Q8SQ43_BAX-01          tggatccaggaccagggtggttgggacggcctcctctcctactttgggac
A0A337S002_BAX-02      tggatccaggaccagggtggttgggacggcctcctctcctactttgggac
A0A337S002_BAX-03      tggatccaggaccagggtggttgggacggcctcctctcctactttgggac
A0A337S002_BAX-01      tggatccaggaccagggtggttgggacggcctcctctcctactttgggac

Q8SQ43_BAX-01          acccacgtggcagacagtgaccatctttgtggcgggagtgctgactgcgt
A0A337S002_BAX-02      acccacgtggcagacagtgaccatctttgtggccggagtgctgactgcgt
A0A337S002_BAX-03      acccacgtggcagacagtgaccatctttgtggccggagtgctgactgcgt
A0A337S002_BAX-01      acccacgtggcagacagtgaccatctttgtggccggagtgctgactgcgt
                       ********************************* ****************

Q8SQ43_BAX-01          cactcgccatctggaaaaagatgggctga
A0A337S002_BAX-02      cactcaccatctggaaaaagatgggctga
A0A337S002_BAX-03      cactcaccatctggaaaaagatgggctga
A0A337S002_BAX-01      cactcaccatctggaaaaagatgggctga
                       ***** ***********************

© 1998-2019