Dataset for CDS BAX of Organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q8SQ43_BAX-01      atggacgggtccggggagcagcccagaggcggggggcacaccagctctgagcagatcatg
M3VUD8_BAX-02      atggacgggtccggggagcagcccagaggcggggg------------tgag---------
M3VUD8_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatg
M3VUD8_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatg
                   ***********************************            ****         

Q8SQ43_BAX-01      aagacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatgggggga
M3VUD8_BAX-02      --------------------------tttcatccaagatcgagcag--------------
M3VUD8_BAX-03      aagacaggggcccttttgcttcagg-----------------------------------
M3VUD8_BAX-01      aagacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatgggggga
                                                                               

Q8SQ43_BAX-01      gagacgcccgagctggccctggagcaggtgccccaggacgcgtccaccaagaagctgagc
M3VUD8_BAX-02      --gacgcccgagctggccctggagcaggtgccccaggacgcgtccaccaagaagctgagc
M3VUD8_BAX-03      ------------------------------------------------------------
M3VUD8_BAX-01      gagacgcccgagctggccctggagcaggtgccccaggacgcgtccaccaagaagctgagc
                                                                               

Q8SQ43_BAX-01      gagtgtctcaagcgcatcggagatgaactggacagtaacatggaattgcagaggatgatc
M3VUD8_BAX-02      gagtgtctcaagcgcatcggagatgaactggacagtaacatggaattgcagaggatgatc
M3VUD8_BAX-03      ----------------------------------------------------ggatgatc
M3VUD8_BAX-01      gagtgtctcaagcgcatcggagatgaactggacagtaacatggaattgcagaggatgatc
                                                                       ********

Q8SQ43_BAX-01      gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttt
M3VUD8_BAX-02      gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttt
M3VUD8_BAX-03      gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttt
M3VUD8_BAX-01      gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttt
                   ************************************************************

Q8SQ43_BAX-01      tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactg
M3VUD8_BAX-02      tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactg
M3VUD8_BAX-03      tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactg
M3VUD8_BAX-01      tccgatggcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactg
                   ************************************************************

Q8SQ43_BAX-01      gtgctcaaggccctgtgtaccaaggtgcccgagctgatccggaccatcatgggctggaca
M3VUD8_BAX-02      gtgctcaaggccctgtgtaccaaggtgcccgagctgatccggaccatcatgggctggaca
M3VUD8_BAX-03      gtgctcaaggccctgtgtaccaaggtgcccgagctgatccggaccatcatgggctggaca
M3VUD8_BAX-01      gtgctcaaggccctgtgtaccaaggtgcccgagctgatccggaccatcatgggctggaca
                   ************************************************************

Q8SQ43_BAX-01      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
M3VUD8_BAX-02      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
M3VUD8_BAX-03      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
M3VUD8_BAX-01      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
                   ************************************************************

Q8SQ43_BAX-01      ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggcgggagtg
M3VUD8_BAX-02      ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtg
M3VUD8_BAX-03      ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtg
M3VUD8_BAX-01      ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtg
                   ***************************************************** ******

Q8SQ43_BAX-01      ctgactgcgtcactcgccatctggaaaaagatgggctga
M3VUD8_BAX-02      ctgactgcgtcactcaccatctggaaaaagatgggctga
M3VUD8_BAX-03      ctgactgcgtcactcaccatctggaaaaagatgggctga
M3VUD8_BAX-01      ctgactgcgtcactcaccatctggaaaaagatgggctga
                   *************** ***********************

© 1998-2018