Dataset for CDS BAX-like of Organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6YGW2_BAX-01       atgaagacaggggcccttttgcttcagggtttcatccagg---atcgcgcggggcggatg
F6XWS9_BAK1-01      atggcg-tccgggcaa----ggcccag-gtcc--tccggggaaggagtgcggagagcctg
F7CDD0_BOK-01       gatgag-ctggagctgatccggcccagtgtct--acc------gcaacgtggctcgccag
                         *    * **      *   *** **     **           * **   *   *

F6YGW2_BAX-01       gggggagacacacc-------------cgagctgggcc-----tggaggaggtgcccc-a
F6XWS9_BAK1-01      ccccgtcctccacttctgaggagcaggtagcccgggac----acggaggaggttttccgc
F7CDD0_BOK-01       ctgaacatctcact------------gcagtctgagaccgtggtgactgacgccttcc-t
                              ***                  * * * *      *   ** *    **  

F6YGW2_BAX-01       ggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgagctggacag
F6XWS9_BAK1-01      agctacgttt------a-------------ttac---cgccaccagcaggagcaggaggc
F7CDD0_BOK-01       ggctgtgtctgcccaga-------------tctt---cgcaggcatcacgtg-----ggg
                     * *  **        *             *      ***       * * *        

F6YGW2_BAX-01       taacatggag---ctgcagaggatgattgcggccgtggacacggactccccccgcgaggt
F6XWS9_BAK1-01      cgagggggcgg--ctgcgcccgccgacccag-----agatggacaccctgcccctggaac
F7CDD0_BOK-01       caaggtggtgtccctgtacttggtggctgcg-----ggg--------ctggccgtgga--
                      *   ** *   ***     *  *     *      *         *   **  *    

F6YGW2_BAX-01       cttt---ttccgagtggcagctgagatgttttccgacggcaacttcaactggggccgggt
F6XWS9_BAK1-01      ctaacagcaccatggggcaggtgg----------ggcggcagctc-------gccatcat
F7CDD0_BOK-01       -------ctgcgtgcggcaggc----------------ccagccc-------gccatggt
                              *  * *****                   ** *         * *    *

F6YGW2_BAX-01       tgttgcccttttctactttgccagcaaattggtgctcaaggccctgagcacaaaattaat
F6XWS9_BAK1-01      cggggacgacatcaatcggcgctacgactcggagttccagaccatg----ctgaagcacc
F7CDD0_BOK-01       ccatgctctcgttgactgcctcggggagtttgtgcgcaagaccctg----gcgacctggc
                        *      *  *      *    * *  * *  * ** ** **       *      

F6YGW2_BAX-01       tgtag--------agtctagattgctggtatg-------gggcacctgtaagagtcctgg
F6XWS9_BAK1-01      tgcagccaacagcagagaacgcctatgagctgttcaccaagatcgcctcgagcctgtttg
F7CDD0_BOK-01       tgcgg--------aggcgtggcggatggactg----------------------------
                    **  *        **          **   **                            

F6YGW2_BAX-01       cgaacgatggctgacctggactcaggtggtagct---gtggaggacggcctcctct----
F6XWS9_BAK1-01      agagcggc--atcaactggggccgagtggtggctctcctggggttcggctaccgcctggc
F7CDD0_BOK-01       ---acgtc--ctcaagtg---------tgtggtcagcacggaccccggctaccgct----
                        **     * *  **          ** *       **    ****  ** *     

F6YGW2_BAX-01       ------------ccgactttgggtcacccacgtggcagac--agtgaccatcttcgtggc
F6XWS9_BAK1-01      cctgcatgtctaccagcgcggcctgaccggcttcctgagccagttgacccgcttcgtggc
F7CDD0_BOK-01       ---------------------------------------cccattggc-----tcgtggc
                                                           *    ** *     *******

F6YGW2_BAX-01       cggagt-------gctcaccgcctcgct--------------------------------
F6XWS9_BAK1-01      tgaattcatgctgcatcactgcattgcccggtggatcgcacagaggggcggctgggtggc
F7CDD0_BOK-01       tgcgtt------------ctgcagtgtc--------------------------------
                     *   *            * **   *                                  

F6YGW2_BAX-01       ---------------------caccatctggaaga-------------------------
F6XWS9_BAK1-01      ggctctggacttgggaaatggccccatccggaatg-tgctgatagttctggctgtggttc
F7CDD0_BOK-01       -------------------ggccgcttcctgaaggctgcc-----ttct-----tcatgc
                                         *  * **  ***                           

F6YGW2_BAX-01       agatgggc------------------------------tga
F6XWS9_BAK1-01      tgttgggccagtatgtggtacgaagattcttcaagtcatga
F7CDD0_BOK-01       tgtt--gccag----------------------agagatga
                     * *  **                              ***

© 1998-2019