Dataset for CDS BAX-like of Organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6YGW2_BAX-02       atggacgggtccggggagcaacccaga--------ggcggggggcccaccagctctgagc
F6YGW2_BAX-01       atggacgggtccggggagcaacccaga--------ggcggggg-----------------
F6XWS9_BAK1-03      atggc--gtccgggcaagg--cccaggtcctccggggaaggag-----------------
F6XWS9_BAK1-01      atggc--gtccgggcaagg--cccaggtcctccggggaaggag-----------------
F6XWS9_BAK1-02      atggc--gtccgggcaagg--cccaggtcctccggggaaggag-----------------
F7CDD0_BOK-01       atgga--ggtgctgcggcgctcctcggtcttcgccgccgagat-----------------
                    ****   *     *       **  *         *    *                   

F6YGW2_BAX-02       agatcatgaagacaggggcccttttgcttcagggtttcatccaggatc-----gcgcggg
F6YGW2_BAX-01       ----------------------------------------tgaggatc-----gcgcggg
F6XWS9_BAK1-03      ----------tgcgga-gagcctgccccgtcctccacttctgaggagcaggtagcccggg
F6XWS9_BAK1-01      ----------tgcgga-gagcctgccccgtcctccacttctgaggagcaggtagcccggg
F6XWS9_BAK1-02      ----------tgcgga-gagcctgccccgtcctccacttctgaggagcaggtagcccggg
F7CDD0_BOK-01       ----------catggacgcctttgaccgctcgcccaccgacaaggagctggtggcccagg
                                                              **** *     ** * **

F6YGW2_BAX-02       g---------cggatggggggagacacacccgagctgg---------------gcctgga
F6YGW2_BAX-01       g---------cggatggggggagacacacccgagctgg---------------gcctgga
F6XWS9_BAK1-03      aca-------cggaggaggttttccgcagctacgtttatt----accgccaccagcagga
F6XWS9_BAK1-01      aca-------cggaggaggttttccgcagctacgtttatt----accgccaccagcagga
F6XWS9_BAK1-02      aca-------cggaggaggttttccgcagctacgtttatt----accgccaccagcagga
F7CDD0_BOK-01       ccaaggcgctcggcagggagttcgtgcacgcgcggctgctgcgcgctggcctcgcctgga
                              ***  * *        **     *                     * ***

F6YGW2_BAX-02       ggaggtgccccagg---------atgcgtccaccaa---------gaagctgagcg-agt
F6YGW2_BAX-01       ggaggtgccccagg---------atgcgtccaccaa---------gaagctgagcg-agt
F6XWS9_BAK1-03      gcaggaggccgagggggcgg---ctgcgcccgccgacc------cagagatggacaccct
F6XWS9_BAK1-01      gcaggaggccgagggggcgg---ctgcgcccgccgacc------cagagatggacaccct
F6XWS9_BAK1-02      gcaggaggccgagggggcgg---ctgcgcccgccgacc------cagagatggacaccct
F7CDD0_BOK-01       gc--gcgcccgagcgtgccgcccctgcccccggcggccgcctggcagaggtgtgcgcggt
                    *   * * ** **           ***  **  *             ** **  *    *

F6YGW2_BAX-02       gtctca----------agcgcatcggagatgagctgga---------------------c
F6YGW2_BAX-01       gtctca----------agcgcatcggagatgagctgga---------------------c
F6XWS9_BAK1-03      gcccctggaacctaacagcaccatggggc--aggtggggcgg---cagctcgccatcatc
F6XWS9_BAK1-01      gcccctggaacctaacagcaccatggggc--aggtggggcgg---cagctcgccatcatc
F6XWS9_BAK1-02      gcccctggaacctaacagcaccatggggc--aggtggggcgg---cagctcgccatcatc
F7CDD0_BOK-01       gctgct-----------gcgcctgggagatgagctggagctgatccggcccagtgtctac
                    *   *            ** *   ** *   ** ***                      *

F6YGW2_BAX-02       agtaacat------------------------ggagctgcagaggatgattg-----cgg
F6YGW2_BAX-01       agtaacat------------------------ggagctgcagaggatgattg-----cgg
F6XWS9_BAK1-03      ggggacgacatcaatcggcgctacgactc---ggagttccagaccatgctgaagcacctg
F6XWS9_BAK1-01      ggggacgacatcaatcggcgctacgactc---ggagttccagaccatgctgaagcacctg
F6XWS9_BAK1-02      ggggacgacatcaatcggcgctacgactc---ggagttccagaccatgctgaagcacctg
F7CDD0_BOK-01       cgcaacgtggctcgccagctgaacatctcactgcagtctgagaccgtggtga-----ctg
                     *  **                          * **    ***   ** *       * *

F6YGW2_BAX-02       ccgtggaca-cggactccccccgcgaggtctttttccgagtggcagctgagatgttttcc
F6YGW2_BAX-01       ccgtggaca-cggactccccccgcgaggtctttttccgagtggcagctgagatgttttcc
F6XWS9_BAK1-03      cagccaacagcagagaacgcctatgagctgttcacc---aagatcgcctcgagcctgttt
F6XWS9_BAK1-01      cagccaacagcagagaacgcctatgagctgttcacc---aagatcgcctcgagcctgttt
F6XWS9_BAK1-02      cagccaacagcagagaacgcctatgagctgttcacc---aagatcgcctcgagcctgttt
F7CDD0_BOK-01       ----------------acgcct------tcctggct---gtgtctgcccagatcttctct
                                     * **       *  *         *   **   **   * *  

F6YGW2_BAX-02       gacggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaattggtg
F6YGW2_BAX-01       gacggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaattggtg
F6XWS9_BAK1-03      gagagcggcatcaactggggccgagtggtggctctcctggggttcggctaccg--c----
F6XWS9_BAK1-01      gagagcggcatcaactggggccgagtggtggctctcctggggttcggctaccg--c----
F6XWS9_BAK1-02      gagagcggcatcaactggggccgagtggtggctctcctggggttcggctaccg--c----
F7CDD0_BOK-01       gca---ggcatcacgtggggcaaggtggtg----tccctgtacttggtggctg--cgggg
                    *       * ***  ******   ** **     *        * *    *         

F6YGW2_BAX-02       ctcaaggcc-----ctgtgcaccaaggtgcccgagctgatcaggaccatcatgggctgga
F6YGW2_BAX-01       ctcaaggcc-----ctgtgcaccaaggtgcccgagctgatcaggaccatcatgggctgga
F6XWS9_BAK1-03      ct---ggcc-----ctgcatgtctaccagcgcggcctgaccggctt---cctgagccag-
F6XWS9_BAK1-01      ct---ggcc-----ctgcatgtctaccagcgcggcctgaccggctt---cctgagccag-
F6XWS9_BAK1-02      ct---ggcc-----ctgcatgtctaccagcgcggcctgaccggctt---cctgagccag-
F7CDD0_BOK-01       ct---ggccgtggactgcgtg-cggcaggcccagcccgccatggtc---catgctctcg-
                    **   ****     ***     *     ** *   * *    *      * **  *  * 

F6YGW2_BAX-02       cactggacttccttcgagagcggct---------------gctgggc----tggatccag
F6YGW2_BAX-01       cactggacttccttcgagagcggct---------------gctgggc----tggatccag
F6XWS9_BAK1-03      ---ttgacccgcttcgtggctgaattcatgctgcatcactgcattgcccggtggatcgca
F6XWS9_BAK1-01      ---ttgacccgcttcgtggctgaattcatgctgcatcactgcattgcccggtggatcgca
F6XWS9_BAK1-02      ---ttgacccgcttcgtggctgaattcatgctgcatcactgcattgcccggtggatcgca
F7CDD0_BOK-01       ---ttga-ctgcctcggg---gagtttgtgc---------gcaagaccctggcgacctgg
                       * **    * *** *   *  *               **    *      ** *   

F6YGW2_BAX-02       gaccagggtggttgg----------------------------------gacggcctcct
F6YGW2_BAX-01       gaccagggtggttgggtgaggcctctgggacccctgagcccaccaccgagacggcctcct
F6XWS9_BAK1-03      cagaggggcggctgggtggcggctctgg-------------acttgggaaatggccccat
F6XWS9_BAK1-01      cagaggggcggctgggtggcggctctgg-------------acttgggaaatggccccat
F6XWS9_BAK1-02      cagaggggcggctgggtggcggctctgg-------------acttgggaaatggccccat
F7CDD0_BOK-01       ctgcggag-----gcgtggcgg--atgg-------------act-----gacgtcctca-
                         * *     *                                    * * ** *  

F6YGW2_BAX-02       ctccgactttgggtcacccacgtggcagacagtgaccatctt-----cgtggc-------
F6YGW2_BAX-01       ctccgactttgggtcacccacgtggcagacagtgaccatctt-----cgtggc-------
F6XWS9_BAK1-03      ccggaatgtgctgatag------ttctggctgtggttctgttgggccagta---------
F6XWS9_BAK1-01      ccggaatgtgctgatag------ttctggctgtggttctgttgggccagta---------
F6XWS9_BAK1-02      ccggaatgtgctgatag------ttctggctgtggttctgttgggccagta---------
F7CDD0_BOK-01       ----agtgtgtggtcagcacggaccccggctaccgctcccattggctcgtggctgcgttc
                            *   *  *         * * *           *      **          

F6YGW2_BAX-02       cggagtgctcaccgcctcg-----------ctcaccatctggaagaagatgggctga---
F6YGW2_BAX-01       cggagtgctcaccgcctcg-----------ctcaccatctggaagaagatgggctgaggc
F6XWS9_BAK1-03      tgtggta------------cgaaga-----ttcttca------------agtcatga---
F6XWS9_BAK1-01      tgtggta------------cgaaga-----ttcttca------------agtcatga---
F6XWS9_BAK1-02      tgtggta------------cgaaga-----ttcttca------------agtcatga---
F7CDD0_BOK-01       tgcagtgtcggccgcttcctgaaggctgccttcttcatgctgttgccagagagatga---
                     *  **                         **  **             *   ***   

F6YGW2_BAX-02       -----------------------------------
F6YGW2_BAX-01       caccagctgccttggactgtgactcttctgcataa
F6XWS9_BAK1-03      -----------------------------------
F6XWS9_BAK1-01      -----------------------------------
F6XWS9_BAK1-02      -----------------------------------
F7CDD0_BOK-01       -----------------------------------

© 1998-2019