Dataset for CDS BAX of Organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6YGW2_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatg
F6YGW2_BAX-01      atggacgggtccggggagcaacccagaggcggggg-------------------------
                   ***********************************                         

F6YGW2_BAX-02      aagacaggggcccttttgcttcagggtttcatccaggatcgcgcggggcggatgggggga
F6YGW2_BAX-01      --------------------------------tgaggatcgcgcggggcggatgggggga
                                                     **************************

F6YGW2_BAX-02      gacacacccgagctgggcctggaggaggtgccccaggatgcgtccaccaagaagctgagc
F6YGW2_BAX-01      gacacacccgagctgggcctggaggaggtgccccaggatgcgtccaccaagaagctgagc
                   ************************************************************

F6YGW2_BAX-02      gagtgtctcaagcgcatcggagatgagctggacagtaacatggagctgcagaggatgatt
F6YGW2_BAX-01      gagtgtctcaagcgcatcggagatgagctggacagtaacatggagctgcagaggatgatt
                   ************************************************************

F6YGW2_BAX-02      gcggccgtggacacggactccccccgcgaggtctttttccgagtggcagctgagatgttt
F6YGW2_BAX-01      gcggccgtggacacggactccccccgcgaggtctttttccgagtggcagctgagatgttt
                   ************************************************************

F6YGW2_BAX-02      tccgacggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaattg
F6YGW2_BAX-01      tccgacggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaattg
                   ************************************************************

F6YGW2_BAX-02      gtgctcaaggccctgtgcaccaaggtgcccgagctgatcaggaccatcatgggctggaca
F6YGW2_BAX-01      gtgctcaaggccctgtgcaccaaggtgcccgagctgatcaggaccatcatgggctggaca
                   ************************************************************

F6YGW2_BAX-02      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgg------
F6YGW2_BAX-01      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgagg
                   ******************************************************      

F6YGW2_BAX-02      ----------------------------gacggcctcctctccgactttgggtcacccac
F6YGW2_BAX-01      cctctgggacccctgagcccaccaccgagacggcctcctctccgactttgggtcacccac
                                               ********************************

F6YGW2_BAX-02      gtggcagacagtgaccatcttcgtggccggagtgctcaccgcctcgctcaccatctggaa
F6YGW2_BAX-01      gtggcagacagtgaccatcttcgtggccggagtgctcaccgcctcgctcaccatctggaa
                   ************************************************************

F6YGW2_BAX-02      gaagatgggctga--------------------------------------
F6YGW2_BAX-01      gaagatgggctgaggccaccagctgccttggactgtgactcttctgcataa
                   *************                                      

© 1998-2019