Dataset for CDS BAK1 of Organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6XWS9_BAK1-02      atggcgtccgggcaaggcccaggtcctccggggaaggagtgcggagagcctgccccgtcc
F6XWS9_BAK1-03      atggcgtccgggcaaggcccaggtcctccggggaaggagtgcggagagcctgccccgtcc
F6XWS9_BAK1-01      atggcgtccgggcaaggcccaggtcctccggggaaggagtgcggagagcctgccccgtcc
                    ************************************************************

F6XWS9_BAK1-02      tccacttctgaggagcaggtagcccgggacacggaggaggttttccgcagctacgtttat
F6XWS9_BAK1-03      tccacttctgaggagcaggtagcccgggacacggaggaggttttccgcagctacgtttat
F6XWS9_BAK1-01      tccacttctgaggagcaggtagcccgggacacggaggaggttttccgcagctacgtttat
                    ************************************************************

F6XWS9_BAK1-02      taccgccaccagcaggagcaggaggccgagggggcggctgcgcccgccgacccagagatg
F6XWS9_BAK1-03      taccgccaccagcaggagcaggaggccgagggggcggctgcgcccgccgacccagagatg
F6XWS9_BAK1-01      taccgccaccagcaggagcaggaggccgagggggcggctgcgcccgccgacccagagatg
                    ************************************************************

F6XWS9_BAK1-02      gacaccctgcccctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
F6XWS9_BAK1-03      gacaccctgcccctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
F6XWS9_BAK1-01      gacaccctgcccctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
                    ************************************************************

F6XWS9_BAK1-02      atcggggacgacatcaatcggcgctacgactcggagttccagaccatgctgaagcacctg
F6XWS9_BAK1-03      atcggggacgacatcaatcggcgctacgactcggagttccagaccatgctgaagcacctg
F6XWS9_BAK1-01      atcggggacgacatcaatcggcgctacgactcggagttccagaccatgctgaagcacctg
                    ************************************************************

F6XWS9_BAK1-02      cagccaacagcagagaacgcctatgagctgttcaccaagatcgcctcgagcctgtttgag
F6XWS9_BAK1-03      cagccaacagcagagaacgcctatgagctgttcaccaagatcgcctcgagcctgtttgag
F6XWS9_BAK1-01      cagccaacagcagagaacgcctatgagctgttcaccaagatcgcctcgagcctgtttgag
                    ************************************************************

F6XWS9_BAK1-02      agcggcatcaactggggccgagtggtggctctcctggggttcggctaccgcctggccctg
F6XWS9_BAK1-03      agcggcatcaactggggccgagtggtggctctcctggggttcggctaccgcctggccctg
F6XWS9_BAK1-01      agcggcatcaactggggccgagtggtggctctcctggggttcggctaccgcctggccctg
                    ************************************************************

F6XWS9_BAK1-02      catgtctaccagcgcggcctgaccggcttcctgagccagttgacccgcttcgtggctgaa
F6XWS9_BAK1-03      catgtctaccagcgcggcctgaccggcttcctgagccagttgacccgcttcgtggctgaa
F6XWS9_BAK1-01      catgtctaccagcgcggcctgaccggcttcctgagccagttgacccgcttcgtggctgaa
                    ************************************************************

F6XWS9_BAK1-02      ttcatgctgcatcactgcattgcccggtggatcgcacagaggggcggctgggtggcggct
F6XWS9_BAK1-03      ttcatgctgcatcactgcattgcccggtggatcgcacagaggggcggctgggtggcggct
F6XWS9_BAK1-01      ttcatgctgcatcactgcattgcccggtggatcgcacagaggggcggctgggtggcggct
                    ************************************************************

F6XWS9_BAK1-02      ctggacttgggaaatggccccatccggaatgtgctgatagttctggctgtggttctgttg
F6XWS9_BAK1-03      ctggacttgggaaatggccccatccggaatgtgctgatagttctggctgtggttctgttg
F6XWS9_BAK1-01      ctggacttgggaaatggccccatccggaatgtgctgatagttctggctgtggttctgttg
                    ************************************************************

F6XWS9_BAK1-02      ggccagtatgtggtacgaagattcttcaagtcatga
F6XWS9_BAK1-03      ggccagtatgtggtacgaagattcttcaagtcatga
F6XWS9_BAK1-01      ggccagtatgtggtacgaagattcttcaagtcatga
                    ************************************

© 1998-2019