Dataset for CDS BAX-like of Organism Epinephelus coioides

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A142K3N5_BOK-01      atggagatgttgcgccgctctt------ctgtgtttgcggctgaagtgtt
A0A219P128_BAX-01      atg--------gcatcgcacccgggaggaggtgatcaaggcaaaagt---
                       ***        **  *** *          *** *   ***  ****   

A0A142K3N5_BOK-01      tgaccgctcgcccaccgaca--aggagctggtgtcccaggccaaagcact
A0A219P128_BAX-01      --aaagatgacataatggaagtaggagctgat----------------tt
                         *  * *  *  *  *  *  ******** *                 *

A0A142K3N5_BOK-01      gtgcagagactacatccactc-caggctgaaccgtgccgggataggctgg
A0A219P128_BAX-01      gttgaaagatttcatataccagcgggttaaaaggcatggagac-ggcagt
                       **  * *** * ***  **   * ** * **  *    * **  *** * 

A0A142K3N5_BOK-01      tctaaacctgagcatggactggctgcatcaggtggggctctggga--gag
A0A219P128_BAX-01      actgca-gtgaccagagaacagctgggtggaggagagctgtgcgacccaa
                        **  *  *** **  **   ****  *   *  * *** ** **   * 

A0A142K3N5_BOK-01      atatca----------tcggtg-ctgctgtggctgggtgacgagctggag
A0A219P128_BAX-01      ataccaagaggcttgcccgatgcctgcagcagattggagatgagctgga-
                       *** **           ** ** **** *  * * ** ** ******** 

A0A142K3N5_BOK-01      taccttcgacccaacgtttaccgcaacgtagcgcgacagctcaacatcac
A0A219P128_BAX-01      -----tgga---aatgttga--gctccaaaggatgataaatgactcttca
                            * **   ** *** *  **  *  **   ** *  * *   *   

A0A142K3N5_BOK-01      cgtggcgtcagagagcattgtgtctgatgctttcctggctgtggctgcag
A0A219P128_BAX-01      ctcagtcccacaaaa----------gacatgttcattaaagttgccattg
                       *   *   ** * *           **    *** *    ** **    *

A0A142K3N5_BOK-01      acattttctccacaggtg------tgacgtgggggaaggtggtgtctttg
A0A219P128_BAX-01      agatctttt---cagatggaagattcaactggggcagggtggttgcactg
                       * ** ** *   *** **      * *  ***** * ******  *  **

A0A142K3N5_BOK-01      tac-gccgtggcaggagccttggcggtgga--ctgtgttcgccatggtca
A0A219P128_BAX-01      ttctactttgcttgtcgacttgtcatcaaagctcttgtgactcatgt---
                       * *  *  **   *  * **** *     *     ***    ****    

A0A142K3N5_BOK-01      tccagctatggtccataccattgtcgattgcatgggggagtttgtccgta
A0A219P128_BAX-01      tcctgatatcatcagaactataatcagctggaccatggactacctccggg
                       *** * ***  **   ** **  **   ** *    *** *   ****  

A0A142K3N5_BOK-01      aaagcctgacctcctggttgaagaggagaggtggctgggtggatgtaaca
A0A219P128_BAX-01      aaaacgtaatcaactggatcagggagcaaggtggctgggagggtat----
                       *** * * * *  **** * * *  *  *********** ** * *    

A0A142K3N5_BOK-01      aagtgcgtggtgaacactgatcccagctt-ccgctctcac-tggctg---
A0A219P128_BAX-01      ----------------tcgggcccactttggcacacccacatggcagacg
                                         *  ****  **  * * * *** **** *   

A0A142K3N5_BOK-01      ------gtgtgtgccgtctgtgcctttggacactacgtgaaggccattgt
A0A219P128_BAX-01      gtgggagtgttcacggctggtgttctc---------------accacttt
                             ****   * *   ***   *                 *** * *

A0A142K3N5_BOK-01      gttatacctcttcagggagaagtga
A0A219P128_BAX-01      actagttatttaca---agatgtga
                         **    * * **   *** ****

© 1998-2018