Dataset for CDS BAX-like of Organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

D2Y5Q2_BCLWAV-01       ----------------atgggacg-----------------gtcagacga
Q9I9N4_BAX-03          ----------------atggcagcgcc--------------gtcgggtgg
I3ITC2_BAX-04          ----------------atggaagcgct--------------gttggatta
I3ITC2_BAX-03          ----------------atggaagcgct--------------gttggatta
A9JSY8_BAX-01          atggcagatgggaagaatggagagacgacagacgaaaatgagttaaaggg
Q08BX9_BAX-01          atggcagatgggaagaatggagagacgacagacgaaaatgagttaaaggg
B0S7M3_BOK-01          -------atgcgggacatgaacgt-----------------gttcgcgcg
B2GRX5_BOK-01          ----------------atgaacgt-----------------gttcgcgcg
Q7T381_BOK-01          ----------------atgaacgt-----------------gttcgcgcg
A0A0R4IZP5_BOK-02      -------atgaagggcatggagat-----------------gttgcgccg
A0A0R4IZP5_BOK-01      -------atgaagggcatggagat-----------------gttgcgccg
Q6DC66_BOK-01          ----------------atggagat-----------------gttgcgccg
                                       ***                      **       

D2Y5Q2_BCLWAV-01       cgctgtgattggtcgaggcctgaacagtccagatccactagtgcgtgaa-
Q9I9N4_BAX-03          aggcg---atacgggcagtggcaatgacc-agatac-ttgacttgggagc
I3ITC2_BAX-04          cgttgttcgtattggcagtggcaatgatc-agacac-ttgatgcaggatc
I3ITC2_BAX-03          cgttgttcgtattggcagtggcaatgatc-agacac-ttgatgcaggatc
A9JSY8_BAX-01          agcta-cagggggtgaagatgtggtagatgatgcga-tcattgagcagag
Q08BX9_BAX-01          agcta-caggtggtgaagatgtggtagacgatgcga-tcattgagcagag
B0S7M3_BOK-01          ctcct-ccgtgctcgccgccgagatgatggatgtgt-tt--------gat
B2GRX5_BOK-01          ctcct-ccgtgctcgccgccgagatgattgatgtgt-tt--------gat
Q7T381_BOK-01          ctcct-ccgtgctcgccgccgagatgattgatgtgt-tt--------gat
A0A0R4IZP5_BOK-02      ctcct-cagtgtttgcggctgaagtcatggaggtgt-tt--------gat
A0A0R4IZP5_BOK-01      ctcct-cagtgtttgcggctgaagtcatggaggtgt-tt--------gat
Q6DC66_BOK-01          ctcct-cagtgtttgcggctgaagtcatggaggtgt-tt--------gat
                                     *  *            *                   

D2Y5Q2_BCLWAV-01       -gcttttctgatgg----------cgtacgactacatcagctacgtgaca
Q9I9N4_BAX-03          tgcacttctcaacaactttgtgtatgagcgtgttcgtcggcatggcgaca
I3ITC2_BAX-04          tgcagttctctttaacttcatctttgaatggcttcatcaacacttagaca
I3ITC2_BAX-03          tgcagttctctttaacttcatctttgaatggcttcatcaacacttagaca
A9JSY8_BAX-01          tgctgttctactta-----------ga--gggtacgt---tattcag--c
Q08BX9_BAX-01          tgctgttctactta-----------ga--gggtacgt---tattcag--c
B0S7M3_BOK-01          cgcactcacacgga-----------gaaagagctcgt---ctttcagtcc
B2GRX5_BOK-01          cgcactcacacgga-----------gaaagagctcgt---ctttcagtcc
Q7T381_BOK-01          cgcactcacacgga-----------gaaagagctcgt---ctttcagtcc
A0A0R4IZP5_BOK-02      cgctctcccacgga-----------caaggagctcgt---gtctcagtcc
A0A0R4IZP5_BOK-01      cgctctcccacgga-----------caaggagctcgt---gtctcagtcc
Q6DC66_BOK-01          cgctctcccacgga-----------caaggagctcgt---gtctcagtcc
                        **  *                       *    * *         *   

D2Y5Q2_BCLWAV-01       gccaaaccaggcgtcccgttgtgtcc-ggcaccttcccgtgcttccgctg
Q9I9N4_BAX-03          g-------ggatgc--tgaagtgacc---------c--------------
I3ITC2_BAX-04          a-------agaagc--tgaaataacctgttggttac--------------
I3ITC2_BAX-03          a-------agaagc--tgaaataacctgttggttac--------------
A9JSY8_BAX-01          a-------agctactatagatgatccaaacattcacgtgagtc-------
Q08BX9_BAX-01          a-------agctactatagatgatccaaacattcacgtgagtc-------
B0S7M3_BOK-01          a-------aggagctgtgtagagact--tcattcactccaggatcacgag
B2GRX5_BOK-01          a-------aggagctgtgtagagact--tcattcactccaggatcacgag
Q7T381_BOK-01          a-------aggagctgtgtagagact--tcattcactccaggatcacgag
A0A0R4IZP5_BOK-02      a-------aagtgttgtgtagggatt--atattcactccagactgcaccg
A0A0R4IZP5_BOK-01      a-------aagtgttgtgtagggatt--atattcactccagactgcaccg
Q6DC66_BOK-01          a-------aagtgttgtgtagggatt--atattcactccagactgcaccg

D2Y5Q2_BCLWAV-01       ccctgcgccacgctgg---------------------agacgagct----
Q9I9N4_BAX-03          ----ggagtcagcttg--------ggggcgtggagctgtgtgaccccagc
I3ITC2_BAX-04          ----aaaataatttgg--------gtattgttgagaaaagtgaccccagc
I3ITC2_BAX-03          ----aaaataatttgg--------gtattgttgagaaaagtgaccccagc
A9JSY8_BAX-01          -------acgagactctcggaggaagacctcaggatgaagaggatc----
Q08BX9_BAX-01          -------acgagactctcggaggaagacctcaggatgaagaggatc----
B0S7M3_BOK-01          agaaggactgagttggtcaaaagtcgagc-tggacctgccagaaccgcgc
B2GRX5_BOK-01          agaaggactgagttggtcaaaagtcgagc-tggacctgccagaaccgcgc
Q7T381_BOK-01          agaaggactgagttggtcaaaagtcgagc-tggacctgccagaaccgcgc
A0A0R4IZP5_BOK-02      ggctggaatcgggtggtcgaaaccagaacacgggtctggaggaacc----
A0A0R4IZP5_BOK-01      ggctggaatcgggtggtcgaaaccagaacacgggtctggaggaacc----
Q6DC66_BOK-01          ggctggaatcgggtggtcgaaaccagaacacgggtctggaggaacc----

D2Y5Q2_BCLWAV-01       ---------gctgatccgcttcccgatcttctttcgccgctggccgagag
Q9I9N4_BAX-03          cataaacgcctcgcgcagtgtttgc---------agcagatcggagatga
I3ITC2_BAX-04          cataaagatgcaatcgagtgtatgg---------tgaggattgcaaatga
I3ITC2_BAX-03          cataaagatgcaatcgagtgtatgg---------tgaggattgcaaatga
A9JSY8_BAX-01          ----ctcaaatcaaagaagttgtagatcagcttttgaagatagctgacga
Q08BX9_BAX-01          ----ctcaaatcaaagaagttgtagatcagcttttgaagatagctgacga
B0S7M3_BOK-01          ggagttcttgtagacgtgtctgtggtgctgc---ttaaactgggtgatga
B2GRX5_BOK-01          ggagttcttgtagacgtgtctgtggtgctgc---ttaaactgggtgatga
Q7T381_BOK-01          ggagttcttgtagacgtgtctgtggtgctgc---ttaaactgggtgatga
A0A0R4IZP5_BOK-02      ------ctggctgaggtgtcttcagtcctgc---tgtggttgggtgatga
A0A0R4IZP5_BOK-01      ------ctggctgaggtgtcttcagtcctgc---tgtggttgggtgatga
Q6DC66_BOK-01          ------ctggctgaggtgtcttcagtcctgc---tgtggttgggtgatga
                                           *                   * *   *   

D2Y5Q2_BCLWAV-01       ttttccagg--------------------------------acgtgacgg
Q9I9N4_BAX-03          gctggatgg--------------------------------aaatgcgca
I3ITC2_BAX-04          aatggaagg--------------------------------aaatgaaga
I3ITC2_BAX-03          aatggaagg--------------------------------aaatgaaga
A9JSY8_BAX-01          cct--------------------------------taacaagaatgctga
Q08BX9_BAX-01          cct--------------------------------taacaagaatgctga
B0S7M3_BOK-01          actggagtgcatgcgtccatatgtgtatcgtaatattgcaaagcagctga
B2GRX5_BOK-01          actggagtgcatgcgtccatatgtgtatcgtaatattgcaaagcagctga
Q7T381_BOK-01          actggagtgcatgcgtccatatgtgtatcgtaatattgcaaagcagctga
A0A0R4IZP5_BOK-02      gctagagtacctgcgtcccaacgtctaccgcaacgtagctcgacagctca
A0A0R4IZP5_BOK-01      gctagagtacctgcgtcccaacgtctaccgcaacgtagctcgacagctca
Q6DC66_BOK-01          gctagagtacctgcgtcccaacgtgtaccgcaacgtagctcgacagctca
                         *                                          *    

D2Y5Q2_BCLWAV-01       agcacacggcctgccccacgctgctctc---------catcctggacgaa
Q9I9N4_BAX-03          gctgcaaagcatgttaaacaactctaatcttcagcc-gactcaagatgtc
I3ITC2_BAX-04          actacaagggatgttaaatagcgctctcttaaatcc-aactctagaacac
I3ITC2_BAX-03          actacaagggatgttaaatagcgctctcttaaatcc-aactctagaacac
A9JSY8_BAX-01          gcttcaacatctcatcagcaccgttcagtcaaactg-cgctcaggacgtc
Q08BX9_BAX-01          gcttcaacatctcatcagcaccgttcagtcaaactg-cgctcaggacgtc
B0S7M3_BOK-01          atatcagcgtatcggtgg------------aagctgtggtttcagatgca
B2GRX5_BOK-01          atatcagcgtatcggtgg------------aagctgtggtttcagatgca
Q7T381_BOK-01          atatcagcgtatcggtgg------------aagctgtggtttcagatgca
A0A0R4IZP5_BOK-02      acatcacaatagcctctg------------agaatatcgtctctgatgcc
A0A0R4IZP5_BOK-01      acatcacaatagcctctg------------agaatatcgtctctgatgcc
Q6DC66_BOK-01          acatcacaatagcctctg------------agaatatcgtctctgatgcc
                           **                                      **    

D2Y5Q2_BCLWAV-01       cacttcgct----cccacgaggcg--------------------------
Q9I9N4_BAX-03          ttcatcagagtggcccgtgagatcttctctga------------------
I3ITC2_BAX-04          tacatccttgtggtcaatgggaccttctctga------------------
I3ITC2_BAX-03          tacatccttgtggtcaatgggaccttctctga------------------
A9JSY8_BAX-01          ttcatgactgtggc--cagaagcatttttgat------------------
Q08BX9_BAX-01          ttcatgactgtggc--cagaagcatttttgat------------------
B0S7M3_BOK-01          tttctctcggtagcaacagaagtcatagccat------------------
B2GRX5_BOK-01          tttctctcggtagcaacagaagtcatagccat------------------
Q7T381_BOK-01          tttctctcggtagcaacagaagtcatagccat------------------
A0A0R4IZP5_BOK-02      tttctggccgtcgctgctgaaatcttctccacaggctctgtct------g
A0A0R4IZP5_BOK-01      tttctggccgtcgctgctgaaatcttctccacagaatatagtcgaaaagg
Q6DC66_BOK-01          tttctggccgtcgctgctgaaatcttctccacagaatatagtcgaaaagg
                           *             *                               

D2Y5Q2_BCLWAV-01       ------------cagggatctggcctggagcgccgtgctgtcggtgttcg
Q9I9N4_BAX-03          ------------tggcaagttcaactggggaagagttgtggcgcttttct
I3ITC2_BAX-04          ------------tgtgacattaagctgg----------------------
I3ITC2_BAX-03          ------------tgtgacattaagctggggtagtgttgtggcactttttt
A9JSY8_BAX-01          -------------gatggcattaactggggacgtgtggtggctctgtttc
Q08BX9_BAX-01          -------------gatggcattaactggggacgtgtggtggctctgtttc
B0S7M3_BOK-01          ---------------gggaatcacatggggtaaagtggtggccatctacg
B2GRX5_BOK-01          ---------------gggaatcacatggggtaaagtggtggccatctacg
Q7T381_BOK-01          ---------------gggaatcacatggggtaaagtggtggccatctacg
A0A0R4IZP5_BOK-02      ttt------ctttacaggtgtaacatgggggaagattgtgtctctgtatg
A0A0R4IZP5_BOK-01      tttggaaaaacataagggtgtaacatgggggaagattgtgtctctgtatg
Q6DC66_BOK-01          tttggaaaaacataagggtgtaacatgggggaagattgtgtctctgtatg
                                           *    ***                      

D2Y5Q2_BCLWAV-01       ttctggctggtcagctggctctgcactgccaggacaggggcatggaggac
Q9I9N4_BAX-03          actttgcctgtcgccttgtcatcaaggctatttcaaccagggttcctgac
I3ITC2_BAX-04          -------------------------ggctgctga----------------
I3ITC2_BAX-03          atgttgcatgtcggtttgttgttaaggctgctgaaatcaactctgttgac
A9JSY8_BAX-01          acctcgcttataggctcattttccaggctctgactcagaaccactttgag
Q08BX9_BAX-01          acctcgcttataggctcattttccaggctctgactcagaaccacttggag
B0S7M3_BOK-01          ctgtagctgccgggcttgcggtggactgtgtgcgactgggccatcctgtc
B2GRX5_BOK-01          ctgtagctgccgggcttgcggtggactgtgtgcgactgggccatcctgtc
Q7T381_BOK-01          ctgtagctgccgggcttgcggtggactgtgtgcgactgggccatcctgtc
A0A0R4IZP5_BOK-02      cagtggctggagctctagctgtggactgtgttcggcatggacatccagca
A0A0R4IZP5_BOK-01      cagtggctggagctctagctgtggactgtgttcggcatggacatccagca
Q6DC66_BOK-01          cagtggctggagctctagctgtggactgtgttcggaatggacatccagca

D2Y5Q2_BCLWAV-01       atcacgccgcagatacaggagtgtgtgggcagctacgtggagagggtcat
Q9I9N4_BAX-03          atcatcagaaccatcataagctggacgatgtcctacattcaggagcacgt
I3ITC2_BAX-04          --------------------------------------------------
I3ITC2_BAX-03          ttggtcagaagcattataaactggactatgccttttattagaaagacctg
A9JSY8_BAX-01          attatcaagaacatcattagctggtttttacagtttatgaagaaacacat
Q08BX9_BAX-01          attatcaagaacatcattagctggtttttacagttcatgaagaaacacat
B0S7M3_BOK-01          atggtgcacactattgtggacagtctgggagagtttgtgcggagaagtct
B2GRX5_BOK-01          atggtgcacactattgtggacagtctgggagagtttgtgcggagaagtct
Q7T381_BOK-01          atggtgcacactattgtggacagtctgggagagtttgtgcggagaagtct
A0A0R4IZP5_BOK-02      atggtgcacactatcgtcgactgcatgggcgagtttgttcgcaaaagcct
A0A0R4IZP5_BOK-01      atggtgcacactatcgtcgactgcatgggcgagtttgttcgcaaaagcct
Q6DC66_BOK-01          atggtgcacactatcgtcgactgcatgggcgagtttgttcgcaaaagcct

D2Y5Q2_BCLWAV-01       ctgc---cccgagatccgggacaaaggaggatggtcaggttttatctctc
Q9I9N4_BAX-03          catt---aactggatcagggaacagggtggatgggacggaatccgcagtt
I3ITC2_BAX-04          --------------------------------------------------
I3ITC2_BAX-03          cattttaacctggatcagggaacagggtggatggggcgcaatccgctcat
A9JSY8_BAX-01          ttct---gcctggatcagacagcaaggaggatgggagggcattttccgca
Q08BX9_BAX-01          ttct---gcctggatcagacagcaaggaggatgggagggcattttccgca
B0S7M3_BOK-01          cgtg---ccatggctcaaaaagagaggaggatgggttgacattttaaaat
B2GRX5_BOK-01          cgtg---ccatggctcaaaaagagaggaggatgggttgacattttaaaat
Q7T381_BOK-01          cgtg---ccatggctcaaaaagagaggaggatgggttgacattttaaaat
A0A0R4IZP5_BOK-02      tgcg---tcatggttaaagaagagaggaggctgggcggacataacaaagt
A0A0R4IZP5_BOK-01      tgcg---tcatggttaaagaagagaggaggctgggcggacataacaaagt
Q6DC66_BOK-01          tgcg---tcatggttaaagaagagaggaggctgggcggacataacaaagt

D2Y5Q2_BCLWAV-01       gctttggagaaaagcagaatcttgaagaccatg--tggtaaaggtgtgtt
Q9I9N4_BAX-03          attttggcac------------------ccccacctggcagacagtcgga
I3ITC2_BAX-04          --------------------------------------------------
I3ITC2_BAX-03          atttcgggac------------------ccccacctggcagacagttgga
A9JSY8_BAX-01          gcatgacgag-atggcgcacagtgtctaccatc--------gcagcagtg
Q08BX9_BAX-01          gcatgacgag-atggcgcacagtgtctaccatc--------gcagcagtg
B0S7M3_BOK-01          gtgtggtgaacatggactctagagctcatgtccattggttatcgacagca
B2GRX5_BOK-01          gtgtggtaaacatggactctagagctcatgtccattggttatcgacagca
Q7T381_BOK-01          gtgtggtaaacatggactctagagctcatgtccattggttatcgacagca
A0A0R4IZP5_BOK-02      gtgtcgtcagtacagaccccagtttccactctcactggctagtaacggcc
A0A0R4IZP5_BOK-01      gtgtcgtcagtacagaccccagtttccactctcactggctagtaacggcc
Q6DC66_BOK-01          gtgtcgtcagtacagaccccagtttccactctcactggctagtaacggcc

D2Y5Q2_BCLWAV-01       gctggtctctgctcctgctgtgtgttggcatcttatcctatttcatatgg
Q9I9N4_BAX-03          gttttcctcgctggagttatcaccacagc----attggtgattcgcaaaa
I3ITC2_BAX-04          --------------------------------------------------
I3ITC2_BAX-03          gttttccttgctggagttcttactgtagg----cttggtgctctacaaaa
A9JSY8_BAX-01          gcgtt---------------cattgtagc----tgt-------tgtttac
Q08BX9_BAX-01          gcgtt---------------cattgtagc----tgt-------tgtttac
B0S7M3_BOK-01          gtgttaacatggagggaattcataaagac----tatgtacgtctacctga
B2GRX5_BOK-01          gtgttaacatggagggaattcataaagac----tatgtacgtctacctga
Q7T381_BOK-01          gtgttaacatggagggaattcataaagac----tatgtacgtctacctga
A0A0R4IZP5_BOK-02      gcctgcgcctgcggtcactaccttaaggc----tgtggttttctacctgc
A0A0R4IZP5_BOK-01      gcctgcgcctgcggtcactaccttaaggc----tgtggttttctacctgc
Q6DC66_BOK-01          gcctgcgcctgcggtcactaccttaaggc----tgtggttttctacctgc

D2Y5Q2_BCLWAV-01       acaagaagaaaaacctag
Q9I9N4_BAX-03          tgtga-------------
I3ITC2_BAX-04          ------------------
I3ITC2_BAX-03          tgtga-------------
A9JSY8_BAX-01          tggagaagaactcgctag
Q08BX9_BAX-01          tggagaagaactcgctag
B0S7M3_BOK-01          cgaagtag----------
B2GRX5_BOK-01          cgaagtag----------
Q7T381_BOK-01          cgaagtag----------
A0A0R4IZP5_BOK-02      tgagagagaaatga----
A0A0R4IZP5_BOK-01      tgagagagaaatga----
Q6DC66_BOK-01          tgagagagaaatga----

© 1998-2019