Dataset for CDS BAX of Organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A9JSY8_BAX-01      atggcagatgggaagaatggagagacgacagacgaaaatgagttaaagggagctacaggg
Q08BX9_BAX-01      atggcagatgggaagaatggagagacgacagacgaaaatgagttaaagggagctacaggt
Q9I9N4_BAX-03      atggc---------------agcgccgtcgggtggaggcg---atacggg------cagt
I3ITC2_BAX-03      atgga---------------agcgctgttggattacgttgttcgtattgg------cagt
I3ITC2_BAX-04      atgga---------------agcgctgttggattacgttgttcgtattgg------cagt
                   ****                ** *  *   *        *     *  **        * 

A9JSY8_BAX-01      ggtgaagatgtggtagatgatgcgatcattgagcag-agtgctgttctacttag----ag
Q08BX9_BAX-01      ggtgaagatgtggtagacgatgcgatcattgagcag-agtgctgttctacttag----ag
Q9I9N4_BAX-03      ggcaatgaccagatacttgacttgg-----gagctgcacttctcaacaactttgtgtatg
I3ITC2_BAX-03      ggcaatgatcagacacttgatgcag-----gatctgcagttctctttaacttcatctttg
I3ITC2_BAX-04      ggcaatgatcagacacttgatgcag-----gatctgcagttctctttaacttcatctttg
                   **  * **   *  *   **          ** * * * * **     ****       *

A9JSY8_BAX-01      ggtacgttattcagcaagctactatagatgatccaaacattcacgtgagtcacgagactc
Q08BX9_BAX-01      ggtacgttattcagcaagctactatagatgatccaaacattcacgtgagtcacgagactc
Q9I9N4_BAX-03      agcgtgttcgtcggcatggcgacagggatg--ctgaagtgacc---------cggagtca
I3ITC2_BAX-03      aatggcttcatcaacacttagacaaagaag--ctgaaataacctgttggttacaaaataa
I3ITC2_BAX-04      aatggcttcatcaacacttagacaaagaag--ctgaaataacctgttggttacaaaataa
                         **  **  **       *  ** *  *  **    *          *       

A9JSY8_BAX-01      tcggaggaagacctcaggatgaagaggatcctcaaat-caaagaagttgtagatcagctt
Q08BX9_BAX-01      tcggaggaagacctcaggatgaagaggatcctcaaat-caaagaagttgtagatcagctt
Q9I9N4_BAX-03      gcttgggg-----gcgtggagctgtgtgaccccagccataaacgcctcgcgcagtgtttg
I3ITC2_BAX-03      tttgggta-----ttgttgagaaaagtgaccccagccataaagatgcaatcgagtgtatg
I3ITC2_BAX-04      tttgggta-----ttgttgagaaaagtgaccccagccataaagatgcaatcgagtgtatg
                        *              *    *   ** **     ***          *     * 

A9JSY8_BAX-01      ttgaagatagctgacgaccttaacaagaatgctgagcttcaacatctcatcagcaccgtt
Q08BX9_BAX-01      ttgaagatagctgacgaccttaacaagaatgctgagcttcaacatctcatcagcaccgtt
Q9I9N4_BAX-03      cagcagatcggagatgagctggatggaaatgcgcagctgcaaagcatgttaaacaactct
I3ITC2_BAX-03      gtgaggattgcaaatgaaatggaaggaaatgaagaactacaagggatgttaaatagcgct
I3ITC2_BAX-04      gtgaggattgcaaatgaaatggaaggaaatgaagaactacaagggatgttaaatagcgct
                     *  *** *   * **  *  *    ****   * ** ***    *  * *  * *  *

A9JSY8_BAX-01      cagtcaaactgcgctcaggacgtcttcatgactgtggccagaagcatttttgatgatggc
Q08BX9_BAX-01      cagtcaaactgcgctcaggacgtcttcatgactgtggccagaagcatttttgatgatggc
Q9I9N4_BAX-03      aatcttcagccgactcaagatgtcttcatcagagtggcccgtgagatcttctctgatggc
I3ITC2_BAX-03      ctcttaaatccaactctagaacactacatccttgtggtcaatgggaccttctctgatgtg
I3ITC2_BAX-04      ctcttaaatccaactctagaacactacatccttgtggtcaatgggaccttctctgatgtg
                          *     ***  **   ** ***    **** *      *  **   *****  

A9JSY8_BAX-01      a---ttaactggggacgtgtggtggctctgtttcacctcgcttataggctcattttccag
Q08BX9_BAX-01      a---ttaactggggacgtgtggtggctctgtttcacctcgcttataggctcattttccag
Q9I9N4_BAX-03      aagttcaactggggaagagttgtggcgcttttctactttgcctgtcgccttgtcatcaag
I3ITC2_BAX-03      acattaagctggggtagtgttgtggcacttttttatgttgcatgtcggtttgttgttaag
I3ITC2_BAX-04      acattaagctgg-----------------------------------------------g
                   *   * * ****                                               *

A9JSY8_BAX-01      gctctgactcagaaccactttgagattatcaagaacatcattagctggtttttacagttt
Q08BX9_BAX-01      gctctgactcagaaccacttggagattatcaagaacatcattagctggtttttacagttc
Q9I9N4_BAX-03      gctatttcaaccagggttcctgacatcatcagaaccatcataagctggacgatgtcctac
I3ITC2_BAX-03      gctgctgaaatcaactctgttgacttggtcagaagcattataaactggactatgcctttt
I3ITC2_BAX-04      gctgctga----------------------------------------------------

A9JSY8_BAX-01      atgaagaaaca---catttctgcctggatcagacagcaaggaggatgggagggcattttc
Q08BX9_BAX-01      atgaagaaaca---catttctgcctggatcagacagcaaggaggatgggagggcattttc
Q9I9N4_BAX-03      attcaggagcacgtcatt---aactggatcagggaacagggtggatgggacggaatccgc
I3ITC2_BAX-03      attagaaagacctgcattttaacctggatcagggaacagggtggatggggcgcaatccgc
I3ITC2_BAX-04      ------------------------------------------------------------

A9JSY8_BAX-01      cg------cagcatgacgagatggcgcacagtgtctaccatcgcagcagtggcgttcatt
Q08BX9_BAX-01      cg------cagcatgacgagatggcgcacagtgtctaccatcgcagcagtggcgttcatt
Q9I9N4_BAX-03      agttattttggcacccccacctggcagacagtcggagttttcctcgctggagttatcacc
I3ITC2_BAX-03      tcatatttcgggacccccacctggcagacagttggagttttccttgctggagttcttact
I3ITC2_BAX-04      ------------------------------------------------------------

A9JSY8_BAX-01      gtagctgttgtttactggagaagaactcgctag
Q08BX9_BAX-01      gtagctgttgtttactggagaagaactcgctag
Q9I9N4_BAX-03      acagcattggtgattcgcaaaatg------tga
I3ITC2_BAX-03      gtaggcttggtgctctacaaaatg------tga
I3ITC2_BAX-04      ---------------------------------

© 1998-2019