Dataset for CDS BOK of Organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2DRF3_BOK-01      atg---------gatgttc-----------------tccggcggtcctct
A0A3Q2EB70_BOK-03      atg---------gagatgc-----------------tgcggcgctcctcc
A0A3Q2EB70_BOK-02      atg---------gagatgc-----------------tgcggcgctcctcc
A0A3Q2EB70_BOK-01      atggttgaagaagagaggcggctggctacattaacgtacgacacacttcg
                       ***         **    *                 * ** *   * ** 

A0A3Q2DRF3_BOK-01      atgtttgcctcagaggtgctggatgtctttgaccgatcagtgaccgagaa
A0A3Q2EB70_BOK-03      gtgtttgcggccgaggtg---------tttgaccgatcccccaccgacaa
A0A3Q2EB70_BOK-02      gtgtttgcggccgaggtg---------tttgaccgatcccccaccgacaa
A0A3Q2EB70_BOK-01      gt--------tcggagag---------tttgaagattttcctgagacctc
                        *          *  * *         *****    *             

A0A3Q2DRF3_BOK-01      agagctggtg----------------------------tctcag-----t
A0A3Q2EB70_BOK-03      ggagctggtg----------------------------tcccag-----g
A0A3Q2EB70_BOK-02      ggagctggtg----------------------------tcccag-----g
A0A3Q2EB70_BOK-01      ggagcctgtgtggatcttggggaaagagtacaacgcgctcacagagaaag
                        ****  ***                            ** ***      

A0A3Q2DRF3_BOK-01      ccaaagcactttgcagagactacatcctttccaggctcaa----------
A0A3Q2EB70_BOK-03      ctaaagctctgtgcagagactacatccactccaggctcca----------
A0A3Q2EB70_BOK-02      ctaaagctctgtgcagagactacatccactccaggctcca----------
A0A3Q2EB70_BOK-01      atgagattctgt-cggacgtcacatcacgactgtggttcacatacaggaa
                          *    ** * * **    *****    *   * *  *          

A0A3Q2DRF3_BOK-01      -------cca----------gaatggattaggatggtccaaaactgaact
A0A3Q2EB70_BOK-03      -------ccgcgc----------cggggtcggctggtccaaagctgagca
A0A3Q2EB70_BOK-02      -------ccgcgc----------cggggtcggctggtccaaagctgagca
A0A3Q2EB70_BOK-01      aaacttcccgcccatcggaggaacggggccgac--gtcggacacagggtg
                              **               **    *    ***  *  * *    

A0A3Q2DRF3_BOK-01      taacttctctccctctaatgcagcag----------------tcgctgaa
A0A3Q2EB70_BOK-03      gggaagc----------gcg--gcggcggggggaaa----gctggcggag
A0A3Q2EB70_BOK-02      gggaagc----------gcg--gcggcggggggaaa----gctggcggag
A0A3Q2EB70_BOK-01      ggggtgt----------atgttacggtgcggccagatgattctgggggag
                                          *   * *                * *  ** 

A0A3Q2DRF3_BOK-01      gtgtctcag-gtgctt-------ctttgtcttggcgatgagttggaaagc
A0A3Q2EB70_BOK-03      gtgtccgcg-gtggtc-------cagtggctgggcgatgagttggag---
A0A3Q2EB70_BOK-02      gtgtccgcg-gtggtc-------cagtggctgggcgatgagttggag---
A0A3Q2EB70_BOK-01      gcgctgatgtgtagacacctaggcagggactgga-gatgggccagagagc
                       * *     * **           *   * ** *  **** *   **    

A0A3Q2DRF3_BOK-01      a----------------tacag-------cccactctgtacaggaac---
A0A3Q2EB70_BOK-03      -----------------tacctccgc---cccaacgtctaccgcaat---
A0A3Q2EB70_BOK-02      -----------------tacctccgc---cccaacgtctaccgcaat---
A0A3Q2EB70_BOK-01      agaaacaaagagaagaatacatcagcattctcaacgccttcattgataaa
                                        ***         * **     * *    *    

A0A3Q2DRF3_BOK-01      -------gtggcaaggcagcttaacatttccgttg--------ccatgga
A0A3Q2EB70_BOK-03      -------gtcgctcgccagctgaacatctcggtgg--------cgataga
A0A3Q2EB70_BOK-02      -------gtcgctcgccagctgaacatctcggtgg--------cgataga
A0A3Q2EB70_BOK-01      aaagacagctactattccatccatcaaatcggtgagctgtcatcctcaga
                              *   *    *     * **  ** **          *    **

A0A3Q2DRF3_BOK-01      g---------------------aatgttgtttcagatgccttcctcagcg
A0A3Q2EB70_BOK-03      g---ggcg-------------tggtgtcc-----gacgccttcatggcca
A0A3Q2EB70_BOK-02      g---ggcg-------------tggtgtcc-----gacgccttcatggcca
A0A3Q2EB70_BOK-01      gctctgcgctctgcctctcactggtttccattcaactgtttttgtggtct
                       *                       * *          *  **  *   * 

A0A3Q2DRF3_BOK-01      tggcaacgg-----------------------------------------
A0A3Q2EB70_BOK-03      tcgctgcag-----------------------------------------
A0A3Q2EB70_BOK-02      tcgctgcag-----------------------------------------
A0A3Q2EB70_BOK-01      ctgctgcagcccagatgggagtgggagagggaaagccgatcggacagtgg
                         **  * *                                         

A0A3Q2DRF3_BOK-01      ----------agatc----------tttgcagcaggt-----------at
A0A3Q2EB70_BOK-03      ----------acatc----------ttctcaacaggc-----gtg-----
A0A3Q2EB70_BOK-02      ----------acatc----------ttctcaacaggc-----gtg-----
A0A3Q2EB70_BOK-01      tacggacccaacaccgtcgcccaggtcctgaagaagctggctgtgtttga
                                 * * *          *    *  * *              

A0A3Q2DRF3_BOK-01      tacatggggtaaagtggta-------------------------------
A0A3Q2EB70_BOK-03      -acgtgggggaaggtggtc-------------------------------
A0A3Q2EB70_BOK-02      -acgtgggggaaggtggtc-------------------------------
A0A3Q2EB70_BOK-01      tacgtggagcaggttagtcgtccacgtggcgatggacaacactgtgatca
                        ** *** * *   * **                                

A0A3Q2DRF3_BOK-01      ----------------gccatgtatgcggtagctgga-------------
A0A3Q2EB70_BOK-03      ----------------tccttgtacgctgtggcggga-------------
A0A3Q2EB70_BOK-02      ----------------tccttgtacgctgtggcggga-------------
A0A3Q2EB70_BOK-01      tcgaggagatcaagcgtctttgcatgccgtggctggacctagcaggtgaa
                                        *  ** * ** ** ** ***             

A0A3Q2DRF3_BOK-01      ---------------------------------------------gccct
A0A3Q2EB70_BOK-03      ---------------------------------------------gctct
A0A3Q2EB70_BOK-02      ---------------------------------------------gctct
A0A3Q2EB70_BOK-01      gcggagggcgaggcggaggtgaacggctgcctggaaggagcgtgcgctct
                                                                    ** **

A0A3Q2DRF3_BOK-01      ggcagtaga----------ctgtgtcagaca-------gggacaccccac
A0A3Q2EB70_BOK-03      ggcggtgga----------ctgcgtacgcca-------tggtcatccagc
A0A3Q2EB70_BOK-02      ggcggtgga----------ctgcgtacgcca-------tggtcatccagc
A0A3Q2EB70_BOK-01      ggctgaggaggaggcggctctatggaggccgctggtcctgctcatcccgc
                       *** *  **          **  *   * *         *  ** **  *

A0A3Q2DRF3_BOK-01      a----acagtgc------acattatagtggacagtct-------------
A0A3Q2EB70_BOK-03      t----atggtcc------acaccatcgtcgactgcat-------------
A0A3Q2EB70_BOK-02      t----atggtcc------acaccatcgtcgactgcat-------------
A0A3Q2EB70_BOK-01      tcaggctgggcctgagtgacattaacgaggcctacattgaaaccctgaag
                               *  *      ***  *  *  * *    *             

A0A3Q2DRF3_BOK-01      -------------------------------------tggacagtttgtc
A0A3Q2EB70_BOK-03      -------------------------------------gggggagttcgtc
A0A3Q2EB70_BOK-02      -------------------------------------gggggagttcgtc
A0A3Q2EB70_BOK-01      caatgcttcatgctgcctcagtccctgggtgttattggggggaaacc---
                                                             **  *       

A0A3Q2DRF3_BOK-01      cgtaagttt-----ctcgtccatt-----ggctgaagaggaa--------
A0A3Q2EB70_BOK-03      cgcaagagt----ctgactccat------ggttgaagaagag--------
A0A3Q2EB70_BOK-02      cgcaagagt----ctgactccat------ggttgaagaagag--------
A0A3Q2EB70_BOK-01      --caacagtgcccattacttcattggttatgtcggagaggagctgatcta
                          **   *         * ***       *  * *** **         

A0A3Q2DRF3_BOK-01      ----------------aggaggatgg------------gcagaaatcatg
A0A3Q2EB70_BOK-03      ----------------aggcggctgg------------gcggatataacg
A0A3Q2EB70_BOK-02      ----------------aggcggctgg------------gcggatataacg
A0A3Q2EB70_BOK-01      tttagacccgcacaccacgcagccggcggtggagcccagcgaagacggcc
                                       * *  *  **            **  * *     

A0A3Q2DRF3_BOK-01      aagtgcgtggtgaaa------atggactgcacc-----------------
A0A3Q2EB70_BOK-03      aagtgcgtggtgaa---------------caccagcccccc---------
A0A3Q2EB70_BOK-02      aagtgcgtggtgaa---------------caccagcccccc---------
A0A3Q2EB70_BOK-01      aggtccccgatgaaacctaccactgtcagcacccgccctgccgcatgcac
                       * ** *  * ****               ****                 

A0A3Q2DRF3_BOK-01      --------------------------------cctgaacggcc-------
A0A3Q2EB70_BOK-03      --------------------------------cttctactccca------
A0A3Q2EB70_BOK-02      --------------------------------cttctactccca------
A0A3Q2EB70_BOK-01      atctgtgagctggacccgtccatcgcagcgggcttcttctgccaaacaga
                                                       * *   *  **       

A0A3Q2DRF3_BOK-01      -----------ttggctatcatctgt------------------------
A0A3Q2EB70_BOK-03      -----------ctggttggtgtctgc------------------------
A0A3Q2EB70_BOK-02      -----------ctggttggtgtctgc------------------------
A0A3Q2EB70_BOK-01      ggatgactttgatgactggtgtctgcgcatccgaaggttgtcctgcaaga
                                   **  *    ****                         

A0A3Q2DRF3_BOK-01      --------------------------------------------------
A0A3Q2EB70_BOK-03      --------------------------------------------------
A0A3Q2EB70_BOK-02      --------------------------------------------------
A0A3Q2EB70_BOK-01      aaggcggcctgcccatgtttgagttggtagacagtcagcccgtccacatg
                                                                         

A0A3Q2DRF3_BOK-01      -----catggattcc--------------------ttcaaatattttctc
A0A3Q2EB70_BOK-03      -----cgtctttgcc--------------------ttcggacactacctg
A0A3Q2EB70_BOK-02      -----cgtctttgcc--------------------ttcggacactacctg
A0A3Q2EB70_BOK-01      gtcagcgtcgacgccctgaaccttactcctgatttctcagactcggaccg
                            * *     **                     **  *      *  

A0A3Q2DRF3_BOK-01      actacagtgtatgtctacatcatgaaggagca------------------
A0A3Q2EB70_BOK-03      aaagctgtggtgttgtacctcctcagggagaa------------------
A0A3Q2EB70_BOK-02      aaagctgtggtgttgtacctcctcagggagaa------------------
A0A3Q2EB70_BOK-01      actggaacggttctttgattccg-aggatgaagagtttgaaatcttgtcc
                       *       *    * *   **   * *  * *                  

A0A3Q2DRF3_BOK-01      --gtga
A0A3Q2EB70_BOK-03      --gtga
A0A3Q2EB70_BOK-02      --gtga
A0A3Q2EB70_BOK-01      ctgtaa
                         ** *

© 1998-2019