Dataset for CDS BAX-like of Organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2DXF3_BAX-02      ------atgctagcatcacat-------------actagccaagaaaggg
A0A3Q2DXF3_BAX-03      tctttcatacaaacattacagtgttgtggtgctagttacctacaaatgtg
A0A3Q2DXF3_BAX-01      ---------------------------------------------atgtg
A0A3Q2E537_BAX-01      --------------atggcagaag--gaggtggaggtgaccaagggaa--
A0A3Q2DRF3_BOK-01      --------------atg---------gatgttc-----------------
A0A3Q2EB70_BOK-03      --------------atg---------gagatgc-----------------
A0A3Q2EB70_BOK-02      --------------atg---------gagatgc-----------------
A0A3Q2EB70_BOK-01      --------------atggttgaagaagagaggcggctggctacattaacg
                                                                         

A0A3Q2DXF3_BAX-02      tct--ctagcattttatgcttaaacaataca------------tcta---
A0A3Q2DXF3_BAX-03      tcttatctgtactctctactctctccaaatgtt---------ttcta---
A0A3Q2DXF3_BAX-01      tcttatctgtactctctactctctccaaatgtt---------ttcta---
A0A3Q2E537_BAX-01      tcc-ggttgatc-ctatggtggaagttggagct----gtgttgctaaagg
A0A3Q2DRF3_BOK-01      tcc-ggcggtcctctatgtttgcctcagaggtgctggatgtctttgaccg
A0A3Q2EB70_BOK-03      tgc-ggcgctcctccgtgtttgcggccgaggtg---------tttgaccg
A0A3Q2EB70_BOK-02      tgc-ggcgctcctccgtgtttgcggccgaggtg---------tttgaccg
A0A3Q2EB70_BOK-01      tac-gacacacttcggt--------tcggagag---------tttgaaga
                       *               *                             *   

A0A3Q2DXF3_BAX-02      ttttcgtcgtgaagtggattcagcg------------------------a
A0A3Q2DXF3_BAX-03      gtttcgtcgtgaagtggattcagcg------------------------a
A0A3Q2DXF3_BAX-01      gtttcgtcgtgaagtggattcagcg------------------------a
A0A3Q2E537_BAX-01      atttcatctaccagcggattcggcg-------------------------
A0A3Q2DRF3_BOK-01      atcagtgaccgagaaagagctggtg-------------------------
A0A3Q2EB70_BOK-03      atcccccaccgacaaggagctggtg-------------------------
A0A3Q2EB70_BOK-02      atcccccaccgacaaggagctggtg-------------------------
A0A3Q2EB70_BOK-01      ttttcctgagacctcggagcctgtgtggatcttggggaaagagtacaacg
                        *              **    * *                         

A0A3Q2DXF3_BAX-02      catgcattaagtaaggtgccgatcctccaggaagc---------gttggg
A0A3Q2DXF3_BAX-03      catgcattaagtaaggtgccgatcctccaggaagc---------gttggg
A0A3Q2DXF3_BAX-01      catgcattaagtaaggtgccgatcctccaggaagc---------gttggg
A0A3Q2E537_BAX-01      -gcacgtagacggcgatactgatgtgacccgggaaca-------gttggg
A0A3Q2DRF3_BOK-01      ---tctcag-----tccaaagcactttgcagagactacatcctttccagg
A0A3Q2EB70_BOK-03      ---tcccag-----gctaaagctctgtgcagagactacatccactccagg
A0A3Q2EB70_BOK-02      ---tcccag-----gctaaagctctgtgcagagactacatccactccagg
A0A3Q2EB70_BOK-01      cgctcacagagaaagatgagattctgt-cggacgtcacatcacgactgtg
                           *                         *                  *

A0A3Q2DXF3_BAX-02      tgtaa---------------------------------cagctctctgtg
A0A3Q2DXF3_BAX-03      tgtaa---------------------------------cagctctctgtg
A0A3Q2DXF3_BAX-01      tgtaa---------------------------------cagctctctgtg
A0A3Q2E537_BAX-01      tgcca---------------------------------cggagctatgtg
A0A3Q2DRF3_BOK-01      ctcaa-----------------cca----------gaatggattaggatg
A0A3Q2EB70_BOK-03      ctcca-----------------ccgcgc----------cggggtcggctg
A0A3Q2EB70_BOK-02      ctcca-----------------ccgcgc----------cggggtcggctg
A0A3Q2EB70_BOK-01      gttcacatacaggaaaaacttcccgcccatcggaggaacggggccgac--
                           *                                   *         

A0A3Q2DXF3_BAX-02      acccacagcagcagaaag--------------------------------
A0A3Q2DXF3_BAX-03      acccacagcagcagaaag--------------------------------
A0A3Q2DXF3_BAX-01      acccacagcagcagaaag--------------------------------
A0A3Q2E537_BAX-01      acccaaacc---------------------------------------at
A0A3Q2DRF3_BOK-01      gtccaaaactgaacttaacttctctccctctaatgcagcag---------
A0A3Q2EB70_BOK-03      gtccaaagctgagcagggaagc----------gcg--gcggcggggggaa
A0A3Q2EB70_BOK-02      gtccaaagctgagcagggaagc----------gcg--gcggcggggggaa
A0A3Q2EB70_BOK-01      gtcggacacagggtgggggtgt----------atgttacggtgcggccag
                         *     *                                         

A0A3Q2DXF3_BAX-02      -------tctctgatgccttt-----------------caggttgttgcg
A0A3Q2DXF3_BAX-03      -------tctctgatgccttt-----------------caggttgttgcg
A0A3Q2DXF3_BAX-01      -------tctctgatgccttt-----------------caggttgttgcg
A0A3Q2E537_BAX-01      ttaaagctcgctca-gtgtctc----------------cagcagattgga
A0A3Q2DRF3_BOK-01      -------tcgctgaagtgtctcag-gtgctt-------ctttgtcttggc
A0A3Q2EB70_BOK-03      a----gctggcggaggtgtccgcg-gtggtc-------cagtggctgggc
A0A3Q2EB70_BOK-02      a----gctggcggaggtgtccgcg-gtggtc-------cagtggctgggc
A0A3Q2EB70_BOK-01      atgattctgggggaggcgctgatgtgtagacacctaggcagggactgga-
                              *     * *                      *      * *  

A0A3Q2DXF3_BAX-02      gatgaa------------------------------------gttccatc
A0A3Q2DXF3_BAX-03      gatgaagtggatggagaaggagggattaaaaagctaatagaggttccatc
A0A3Q2DXF3_BAX-01      gatgaa------------------------------------gttccatc
A0A3Q2E537_BAX-01      gatgagctggatggaaacatggagctgcagaggatgatag----------
A0A3Q2DRF3_BOK-01      gatgagttggaaagca----------------tacag-------cccact
A0A3Q2EB70_BOK-03      gatgagttggag--------------------tacctccgc---cccaac
A0A3Q2EB70_BOK-02      gatgagttggag--------------------tacctccgc---cccaac
A0A3Q2EB70_BOK-01      gatgggccagagagcagaaacaaagagaagaatacatcagcattctcaac
                       ****                                              

A0A3Q2DXF3_BAX-02      attcactc------------------------------------------
A0A3Q2DXF3_BAX-03      attcactc------------------------------------------
A0A3Q2DXF3_BAX-01      attcactc------------------------------------------
A0A3Q2E537_BAX-01      ----------------------aggactctgccctcaaac----------
A0A3Q2DRF3_BOK-01      ctgtacaggaac----------gtggcaaggcagcttaacatttccgttg
A0A3Q2EB70_BOK-03      gtctaccgcaat----------gtcgctcgccagctgaacatctcggtgg
A0A3Q2EB70_BOK-02      gtctaccgcaat----------gtcgctcgccagctgaacatctcggtgg
A0A3Q2EB70_BOK-01      gccttcattgataaaaaagacagctactattccatccatcaaatcggtga
                                                                         

A0A3Q2DXF3_BAX-02      --------cctcaaag---------------------------------g
A0A3Q2DXF3_BAX-03      --------cctcaaag---------------------------------g
A0A3Q2DXF3_BAX-01      --------cctcaaag---------------------------------g
A0A3Q2E537_BAX-01      --------caacaaaa---------------------------------g
A0A3Q2DRF3_BOK-01      --------ccatggag---------------------aatgttgtttcag
A0A3Q2EB70_BOK-03      --------cgatagag---ggcg-------------tggtgtcc-----g
A0A3Q2EB70_BOK-02      --------cgatagag---ggcg-------------tggtgtcc-----g
A0A3Q2EB70_BOK-01      gctgtcatcctcagagctctgcgctctgcctctcactggtttccattcaa
                               *     *                                   

A0A3Q2DXF3_BAX-02      aagtgtttgtgaaaattgtccgcg--------------------------
A0A3Q2DXF3_BAX-03      aagtgtttgtgaaaattgtccgcg--------------------------
A0A3Q2DXF3_BAX-01      aagtgtttgtgaaaattgtccgcg--------------------------
A0A3Q2E537_BAX-01      atgtcttcatgaaagtggcacttc--------------------------
A0A3Q2DRF3_BOK-01      atgccttcctcagcgtggcaacgg--------------------------
A0A3Q2EB70_BOK-03      acgccttcatggccatcgctgcag--------------------------
A0A3Q2EB70_BOK-02      acgccttcatggccatcgctgcag--------------------------
A0A3Q2EB70_BOK-01      ctgtttttgtggtctctgctgcagcccagatgggagtgggagagggaaag
                         *  **  *       *                                

A0A3Q2DXF3_BAX-02      -------------------------aactc----------ttttccgatg
A0A3Q2DXF3_BAX-03      -------------------------aactc----------ttttccgatg
A0A3Q2DXF3_BAX-01      -------------------------aactc----------ttttccgatg
A0A3Q2E537_BAX-01      -------------------------agatc----------ttttctgatg
A0A3Q2DRF3_BOK-01      -------------------------agatc----------tttgcagcag
A0A3Q2EB70_BOK-03      -------------------------acatc----------ttctcaacag
A0A3Q2EB70_BOK-02      -------------------------acatc----------ttctcaacag
A0A3Q2EB70_BOK-01      ccgatcggacagtggtacggacccaacaccgtcgcccaggtcctgaagaa
                                                *   *          *         

A0A3Q2DXF3_BAX-02      gggagatc--------aactggggcagggtggtt----------------
A0A3Q2DXF3_BAX-03      gggagatc--------aactggggcagggtggtt----------------
A0A3Q2DXF3_BAX-01      gggagatc--------aactggggcagggtggtt----------------
A0A3Q2E537_BAX-01      gtagattc--------aactggggtcgagtggtt----------------
A0A3Q2DRF3_BOK-01      gt-----------attacatggggtaaagtggta----------------
A0A3Q2EB70_BOK-03      gc-----gtg------acgtgggggaaggtggtc----------------
A0A3Q2EB70_BOK-02      gc-----gtg------acgtgggggaaggtggtc----------------
A0A3Q2EB70_BOK-01      gctggctgtgtttgatacgtggagcaggttagtcgtccacgtggcgatgg
                       *               *  *** *     * **                 

A0A3Q2DXF3_BAX-02      ----------------------------------------accgtcttct
A0A3Q2DXF3_BAX-03      ----------------------------------------accgtcttct
A0A3Q2DXF3_BAX-01      ----------------------------------------accgtcttct
A0A3Q2E537_BAX-01      --------------------------------------gcgctgttct--
A0A3Q2DRF3_BOK-01      -------------------------------gccatgtatgcggtagctg
A0A3Q2EB70_BOK-03      -------------------------------tccttgtacgctgtggcgg
A0A3Q2EB70_BOK-02      -------------------------------tccttgtacgctgtggcgg
A0A3Q2EB70_BOK-01      acaacactgtgatcatcgaggagatcaagcgtctttgcatgccgtggctg
                                                                * **     

A0A3Q2DXF3_BAX-02      --------------------------------------------------
A0A3Q2DXF3_BAX-03      --------------------------------------------------
A0A3Q2DXF3_BAX-01      --------------------------------------------------
A0A3Q2E537_BAX-01      --------------------------------------------------
A0A3Q2DRF3_BOK-01      ga------------------------------------------------
A0A3Q2EB70_BOK-03      ga------------------------------------------------
A0A3Q2EB70_BOK-02      ga------------------------------------------------
A0A3Q2EB70_BOK-01      gacctagcaggtgaagcggagggcgaggcggaggtgaacggctgcctgga
                                                                         

A0A3Q2DXF3_BAX-02      ----------gctttgccggcatg------tttgtcttgaaagctc----
A0A3Q2DXF3_BAX-03      ----------gctttgccggcatg------tttgtcttgaaagctc----
A0A3Q2DXF3_BAX-01      ----------gctttgccggcatg------tttgtcttgaaagctc----
A0A3Q2E537_BAX-01      ----------actttgcctgtcga------ctcgtcataaaagccc----
A0A3Q2DRF3_BOK-01      ----------gccctggcagtaga----------ctgtgtcagaca----
A0A3Q2EB70_BOK-03      ----------gctctggcggtgga----------ctgcgtacgcca----
A0A3Q2EB70_BOK-02      ----------gctctggcggtgga----------ctgcgtacgcca----
A0A3Q2EB70_BOK-01      aggagcgtgcgctctggctgaggaggaggcggctctatggaggccgctgg
                                  *  ** * *                      *       

A0A3Q2DXF3_BAX-02      ---atgaaagcaaaat----atgtgagttaatcaaaaccataatcagctg
A0A3Q2DXF3_BAX-03      ---atgaaagcaaaat----atgtgagttaatcaaaaccataatcagctg
A0A3Q2DXF3_BAX-01      ---atgaaagcaaaat----atgtgagttaatcaaaaccataatcagctg
A0A3Q2E537_BAX-01      ---ttatcaccaaaatt---cca-gaaatcatcagaactataatcaactg
A0A3Q2DRF3_BOK-01      ---gggacaccccaca----aca-gtgc------acattatagtggacag
A0A3Q2EB70_BOK-03      ---tggtcatccagct----atg-gtcc------acaccatcgtcgactg
A0A3Q2EB70_BOK-02      ---tggtcatccagct----atg-gtcc------acaccatcgtcgactg
A0A3Q2EB70_BOK-01      tcctgctcatcccgctcaggctg-ggcctgagtgacattaacgaggccta
                               * *             *           *  *       *  

A0A3Q2DXF3_BAX-02      gat-----------------------------------------------
A0A3Q2DXF3_BAX-03      gat-----------------------------------------------
A0A3Q2DXF3_BAX-01      gat-----------------------------------------------
A0A3Q2E537_BAX-01      gac-----------------------------------------------
A0A3Q2DRF3_BOK-01      tct-----------------------------------------------
A0A3Q2EB70_BOK-03      cat-----------------------------------------------
A0A3Q2EB70_BOK-02      cat-----------------------------------------------
A0A3Q2EB70_BOK-01      cattgaaaccctgaagcaatgcttcatgctgcctcagtccctgggtgtta
                                                                         

A0A3Q2DXF3_BAX-02      ---catagactttttccgagaaa---------aggtgcttggctggataa
A0A3Q2DXF3_BAX-03      ---catagactttttccgagaaa---------aggtgcttggctggataa
A0A3Q2DXF3_BAX-01      ---catagactttttccgagaaa---------aggtgcttggctggataa
A0A3Q2E537_BAX-01      ---catagactacatccggga---------tcatgtgatcaactggatca
A0A3Q2DRF3_BOK-01      ---tggacagtttgtccgtaagttt-----ctcgtccatt-----ggctg
A0A3Q2EB70_BOK-03      ---gggggagttcgtccgcaagagt----ctgactccat------ggttg
A0A3Q2EB70_BOK-02      ---gggggagttcgtccgcaagagt----ctgactccat------ggttg
A0A3Q2EB70_BOK-01      ttggggggaaacc-----caacagtgcccattacttcattggttatgtcg
                               *           *                 *           

A0A3Q2DXF3_BAX-02      aggagca-------------------------aggcggctgg--------
A0A3Q2DXF3_BAX-03      aggagca-------------------------aggcggctgg--------
A0A3Q2DXF3_BAX-01      aggagca-------------------------aggcggctgg--------
A0A3Q2E537_BAX-01      gagagca-------------------------aggtggctgg--------
A0A3Q2DRF3_BOK-01      aagaggaa------------------------aggaggatgg--------
A0A3Q2EB70_BOK-03      aagaagag------------------------aggcggctgg--------
A0A3Q2EB70_BOK-02      aagaagag------------------------aggcggctgg--------
A0A3Q2EB70_BOK-01      gagaggagctgatctatttagacccgcacaccacgcagccggcggtggag
                         **  *                         * *  *  **        

A0A3Q2DXF3_BAX-02      ----gagggaat------------------------------tttttcct
A0A3Q2DXF3_BAX-03      ----gagggaat------------------------------tttttcct
A0A3Q2DXF3_BAX-01      ----gagggaat------------------------------tttttcct
A0A3Q2E537_BAX-01      ----gagggtat------------------------------tcgctcct
A0A3Q2DRF3_BOK-01      ----gcagaaatcatgaagtgcgtggtgaaa------atggactgcacc-
A0A3Q2EB70_BOK-03      ----gcggatataacgaagtgcgtggtgaa---------------cacca
A0A3Q2EB70_BOK-02      ----gcggatataacgaagtgcgtggtgaa---------------cacca
A0A3Q2EB70_BOK-01      cccagcgaagacggccaggtccccgatgaaacctaccactgtcagcaccc
                           *     *                                    ** 

A0A3Q2DXF3_BAX-02      acgtcggcatt-------------------------------------cc
A0A3Q2DXF3_BAX-03      acgtcggcatt-------------------------------------cc
A0A3Q2DXF3_BAX-01      acgtcggcatt-------------------------------------cc
A0A3Q2E537_BAX-01      acttcggcacg-------------------------------------cc
A0A3Q2DRF3_BOK-01      ------------------------------------------------cc
A0A3Q2EB70_BOK-03      gcccccc-----------------------------------------ct
A0A3Q2EB70_BOK-02      gcccccc-----------------------------------------ct
A0A3Q2EB70_BOK-01      gccctgccgcatgcacatctgtgagctggacccgtccatcgcagcgggct
                                                                       * 

A0A3Q2DXF3_BAX-02      catgtggcaa-----------------tttttggggattttt--------
A0A3Q2DXF3_BAX-03      catgtggcaa-----------------tttttggggattttt--------
A0A3Q2DXF3_BAX-01      catgtggcaa-----------------tttttggggattttt--------
A0A3Q2E537_BAX-01      tacatggcag-----------------acggtgggtgtcttc--------
A0A3Q2DRF3_BOK-01      tgaacggcc------------------ttggctatcatctgt--------
A0A3Q2EB70_BOK-03      tctactccca-----------------ctggttggtgtctgc--------
A0A3Q2EB70_BOK-02      tctactccca-----------------ctggttggtgtctgc--------
A0A3Q2EB70_BOK-01      tcttctgccaaacagaggatgactttgatgactggtgtctgcgcatccga
                              *                             * *          

A0A3Q2DXF3_BAX-02      --------------------------------------------------
A0A3Q2DXF3_BAX-03      --------------------------------------------------
A0A3Q2DXF3_BAX-01      --------------------------------------------------
A0A3Q2E537_BAX-01      --------------------------------------------------
A0A3Q2DRF3_BOK-01      --------------------------------------------------
A0A3Q2EB70_BOK-03      --------------------------------------------------
A0A3Q2EB70_BOK-02      --------------------------------------------------
A0A3Q2EB70_BOK-01      aggttgtcctgcaagaaaggcggcctgcccatgtttgagttggtagacag
                                                                         

A0A3Q2DXF3_BAX-02      -------------ctggctggggttgtcacc-------------------
A0A3Q2DXF3_BAX-03      -------------ctggctggggttgtcacc-------------------
A0A3Q2DXF3_BAX-01      -------------ctggctggggttgtcacc-------------------
A0A3Q2E537_BAX-01      -------------ctggctggagttcttgcc-------------------
A0A3Q2DRF3_BOK-01      ---------------------catggattcc-------------------
A0A3Q2EB70_BOK-03      ---------------------cgtctttgcc-------------------
A0A3Q2EB70_BOK-02      ---------------------cgtctttgcc-------------------
A0A3Q2EB70_BOK-01      tcagcccgtccacatggtcagcgtcgacgccctgaaccttactcctgatt
                                              *     **                   

A0A3Q2DXF3_BAX-02      -------------------------acccttgtcgtcgtccacaagat--
A0A3Q2DXF3_BAX-03      -------------------------acccttgtcgtcgtccacaagat--
A0A3Q2DXF3_BAX-01      -------------------------acccttcaaacca---agaagtt--
A0A3Q2E537_BAX-01      -------------------------actgtttttgtcatgcgcaagat--
A0A3Q2DRF3_BOK-01      -ttcaaatattttctcactacagtgtatgtctacatcatgaaggagca--
A0A3Q2EB70_BOK-03      -ttcggacactacctgaaagctgtggtgttgtacctcctcagggagaa--
A0A3Q2EB70_BOK-02      -ttcggacactacctgaaagctgtggtgttgtacctcctcagggagaa--
A0A3Q2EB70_BOK-01      tctcagactcggaccgactggaacggttctttgattccg-aggatgaaga
                                                    *      *        *    

A0A3Q2DXF3_BAX-02      gaggg---------ccgaatga
A0A3Q2DXF3_BAX-03      gaggg---------ccgaatga
A0A3Q2DXF3_BAX-01      aatgggaggatttacagagtaa
A0A3Q2E537_BAX-01      ------------------gtga
A0A3Q2DRF3_BOK-01      ------------------gtga
A0A3Q2EB70_BOK-03      ------------------gtga
A0A3Q2EB70_BOK-02      ------------------gtga
A0A3Q2EB70_BOK-01      gtttgaaatcttgtccctgtaa
                                          * *

© 1998-2019