Dataset for CDS BAX-like of Organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8X0F2_BAX-01      atgg------------------cagcgcacccgggaggagacgatgacgg
A0A3P8VGS5_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggctgaa---------gt
A0A3P8WH41_BOK-01      atggaggttctgcggaggtcttctgtgtttgcagcagaggtcctggatgt
                       ****                  * * *    * *  *           * 

A0A3P8X0F2_BAX-01      taccaacagggatcaattactggaattaggacgtatt----ctgttgaag
A0A3P8VGS5_BOK-01      gttcgacc--gctcgcccaccgaca--aggagctggtgtcccaggcgaaa
A0A3P8WH41_BOK-01      gtttgacc--gctcactgactgaga--aggacctagtgtcccagtccaaa
                            **   * **    ** *  *  ****  *  *    * *   ** 

A0A3P8X0F2_BAX-01      gatttcatctatgaacgtgttcaacggaatagagacagcaatgctgttgt
A0A3P8VGS5_BOK-01      gctctgtgccgagactacatcaact---caaggctgaatcgtgtcggtat
A0A3P8WH41_BOK-01      gccctttgcagagactacattctgt---tcagactcaaccagaatgggct
                       *   *   *   **     *          **    *        *   *

A0A3P8X0F2_BAX-01      gaccaggtcacagcttggagcaggggagctctgtgacccaaaccacaa--
A0A3P8VGS5_BOK-01      gggctggac-tagccctgaacacggactagcttcatcctcagggacaatg
A0A3P8WH41_BOK-01      gggatggtc-caaatctgagctcaacctcgtgccctccaatgcagcactc
                       *    ** *  *     ** *               **       **   

A0A3P8X0F2_BAX-01      ---gaagctggctcagtgtcttcagcaaattggagacgagctcg------
A0A3P8VGS5_BOK-01      agagagatttcatcggt-tttgctgtggttaggcgatgagctggaatacc
A0A3P8WH41_BOK-01      gctgaagtgtcttcagt-tcttctgtgcctcggcgacgagctggagtgtt
                          **       ** ** * * * *    * ** ** ***** *      

A0A3P8X0F2_BAX-01      ---------------atggaaatgtagaactccaaaggatgatagagaac
A0A3P8VGS5_BOK-01      tccgacccaatgtttatcgtaacgtagcgc------ggcagctaaatatc
A0A3P8WH41_BOK-01      tacagccatctttgtacaggaacgtggcac------ggcagctcagcatc
                                      *  * ** ** *  *      **  * *    * *

A0A3P8X0F2_BAX-01      tcttcactcagtcccaccagagaa-------------gtgtttatgagag
A0A3P8VGS5_BOK-01      act-------gttgcctcggagagtgtggtctctgacgccttcctggctg
A0A3P8WH41_BOK-01      tct-------gttgccatggagaacatggtctccgatgcgttcattggtg
                        **       **  *    ****              *  **  *    *

A0A3P8X0F2_BAX-01      tagcctacgagatcttttcagacgggaaattcaactggggccgagtggta
A0A3P8VGS5_BOK-01      tggcggctgacattttctc-tacaggta--taacatggggaaaggtggtg
A0A3P8WH41_BOK-01      tgtcaacagaaatctttgc-tacaggta--taacctggggtaaagttgtg
                       *  *    ** ** **  *  ** ** *  * *  *****    ** ** 

A0A3P8X0F2_BAX-01      gctctgttctacttcgcctgtcgactcgtcatcaaagctctggtgaccca
A0A3P8VGS5_BOK-01      tccttg-tacgcagtggcgggggccttggcagtgga-ttgtgttcgccat
A0A3P8WH41_BOK-01      gccatg-tatgctgtagctgcagccctggccgtgga-ctgtgtcagacaa
                        *  ** *   *     * *  * *  * *     *  * **     *  

A0A3P8X0F2_BAX-01      agtc--cctgacatcatcagaaccatcatcaactggaccgttgattacct
A0A3P8VGS5_BOK-01      ggtcatccttcaatcgtccataccattgtggactgcatgggagagtttgt
A0A3P8WH41_BOK-01      gaccgggcggccaacgtcaacatcatagtgcagagtctgggacagtttgt
                          *   *    * * **   * ***  *  *  *    *   * *   *

A0A3P8X0F2_BAX-01      tcgtgaaaatgtaatcaactggatcatggagcaaggtggctgggagggca
A0A3P8VGS5_BOK-01      ccgcaagagtctgacctcctggttaaaaaaaagaggcggctggatggatg
A0A3P8WH41_BOK-01      ccgcaagttcctggtttcctggctgaagagacggggaggatggggtgata
                        **  *     *      **** * *        ** ** ***   *   

A0A3P8X0F2_BAX-01      ttcgttcctactttggca---------ctcccacatggcaga--------
A0A3P8VGS5_BOK-01      tcactaagtgtgtggtcaatactga-----ccccagattcagctctcact
A0A3P8WH41_BOK-01      tcacgaaatgtgtggtaaagaaagattttcccccagaacaga-----act
                       *       *   * *  *            ** **               

A0A3P8X0F2_BAX-01      ---------cggtgggagttttcttggctggcgttc-----tc-------
A0A3P8VGS5_BOK-01      ggtt------ggtgatggctgcct----gtacctttggacattatgtgaa
A0A3P8WH41_BOK-01      ggttaacctcggtcatggagtccctgaagtactttc-----tt-------
                                 ***    *    *        * **      *        

A0A3P8X0F2_BAX-01      -accactg------tcattgtcatacggaaaatgtga
A0A3P8VGS5_BOK-01      gaccattgtgt---tgtacctgctcagggagaagtga
A0A3P8WH41_BOK-01      -accacagtgtacgtctacatcatgaaagagccatga
                        ****  *      *     *  *     *    ***

© 1998-2019