Dataset for CDS BAX-like of Organism Crassostrea hongkongensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0C5DGQ6_BAX-01       atgacatcgtctgacagctt-tcgaccattcgtgaaagaa----------
A0A0C5DYM0_BAK1-01      atggcttactgggacggtggatcggggacacggggagggggaagggtccc
                        *** * *  *  *** *    ***   *  ** * * *            

A0A0C5DGQ6_BAX-01       ----ccctcaggtgtgacccggcag-----------ctcagtaaggatga
A0A0C5DYM0_BAK1-01      tccttcctcagacgt---ccgccagatcccctctccctcagagcaaatga
                             ******  **   *** ***           *****     ****

A0A0C5DGQ6_BAX-01       --------------------------ggtggggcagcaggctcgagttct
A0A0C5DYM0_BAK1-01      cgcccgacacggaggagaatgtcattgatgaggcggaggacgtga-----
                                                  * ** *** *  * *  **     

A0A0C5DGQ6_BAX-01       tctcctcaaccagttcatacaggacagactggccactgagagaagtgaag
A0A0C5DYM0_BAK1-01      -----tcaggaactttatat---------------ttgagagttatcagc
                             ***   * ** ***                 ******   * *  

A0A0C5DGQ6_BAX-01       agcaagtgttgcatatggaagatttacaagaccctggcacacccacaggt
A0A0C5DYM0_BAK1-01      atcagctgacagaggaggtggacactctggattccaccac-cccccaggt
                        * **  **    *   **  **    *  **  *   *** *** *****

A0A0C5DGQ6_BAX-01       cctccactggaatatgtgcgagaa-----------attggccgagcttta
A0A0C5DYM0_BAK1-01      cc----cggagctgtgtgccttcacgtccgatcccatgagtcgagcttca
                        **    * *   * *****    *           **  * ******* *

A0A0C5DGQ6_BAX-01       cg------------------ttgcataggagatgagctggata---gaaa
A0A0C5DYM0_BAK1-01      caagttggtcggcagttggctaggattggagatgacataaataggcgata
                        *                   * * ** ********  *  ***   ** *

A0A0C5DGQ6_BAX-01       tg--aacagattcaga-acctgtgtgaccaa------gtaaacccaagtg
A0A0C5DYM0_BAK1-01      tgccgatgaattcaaagacatgattaatcagctgaatgtgaatgaagata
                        **   *   ***** * ** **  * * **       ** **   *  * 

A0A0C5DGQ6_BAX-01       caaaccatgaaacattcttcaatgttgccaacagtttctttgctgatggt
A0A0C5DYM0_BAK1-01      cagcctatgaagtgttcgctggagttgccaaaaagttgtttgcggatgaa
                        **  * *****   ***      ******** *  ** ***** ****  

A0A0C5DGQ6_BAX-01       gtttacaactggggcagagtgggatgtctattctactttgcctacaaaat
A0A0C5DYM0_BAK1-01      at---aaactggggccgggtggcagctttaatgtgcctagcgtaccgtat
                         *    ********* * **** *  * ** * * * * ** ***   **

A0A0C5DGQ6_BAX-01       ggcagtaaaggcctt----gagtaa---aatcaatttgatcagatc----
A0A0C5DYM0_BAK1-01      cactatgactgttgtcaaagagaaagccaaaaagttcgctcagttcatga
                          *  * *  *   *    *** **   **  * ** * **** **    

A0A0C5DGQ6_BAX-01       ----tatagtgaactgggtggtgaactttatcacagattatgtggctggc
A0A0C5DYM0_BAK1-01      aggtcattgttagtcatgttgttcggttcattaaagagaaaatagctggg
                             ** ** *     ** **    ** ** * ***  *  * ***** 

A0A0C5DGQ6_BAX-01       tggatcatagatagaggcggatgggatgccatcatagaatattttgggac
A0A0C5DYM0_BAK1-01      tggatcgcaagtcaagggggatggagtgccgccctccagtactcc----c
                        ******  *  *  *** ******  ****  * *  * ** *      *

A0A0C5DGQ6_BAX-01       cccacaaaa---------------tcagttttttggagtcgtcggcctag
A0A0C5DYM0_BAK1-01      cttccatgagttttacctccctctccattgttgtggggtcgt--gcttgg
                        *   **  *                ** * ** *** *****  ** * *

A0A0C5DGQ6_BAX-01       gattaacagtttgtgctggcctctaccttttgaaggcgctcaaataa
A0A0C5DYM0_BAK1-01      ---cagccattgctgctgtgttctacttcagcaagaag---agttga
                            * *  **  *****   ***** *    ***  *   *  * *

© 1998-2019