Dataset for CDS BAX-like of Organism Crassostrea gigas

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

K1P6Q7_BAK1-01      atggctgaaagcaaaaaaacggagttggagatccatagggagatgatgacactgttatca
K1RL21_BAX-01       atggagga----------------------------------------------------
                    ****  **                                                    

K1P6Q7_BAK1-01      catcttagggaaaataagaccagagttcgcaagaaagtacctatggcccaaacatcaaag
K1RL21_BAX-01       ------------------------------------------------------------

K1P6Q7_BAK1-01      caagaaatcaaagctgacgttcgcaaaatcttggaacaattcctaaagaaacaacaactg
K1RL21_BAX-01       -------------------tttacaagaccccggcac-----------------------
                                       **  *** * *  ** **                       

K1P6Q7_BAK1-01      aacgatgatgaagaggaaggtgcaataccaactggatttcagagagaagatgtt-gagaa
K1RL21_BAX-01       --------------------------acccacaggtcctccactggaatatgttcgagaa
                                              *** ** **   **     *** ***** *****

K1P6Q7_BAK1-01      tgtgactgaaacttatcgatcaggcagcacaaacacatcttgggaagaatacgagtgcct
K1RL21_BAX-01       attggcagagcttta---------------------------------------------
                      ** * **   ***                                             

K1P6Q7_BAK1-01      tcgttgtgaggcaggatgccggagcaaagtcatcaagtccattcccacttgttctaatcg
K1RL21_BAX-01       -cgttgc-----------------------------------------------------

K1P6Q7_BAK1-01      atctcccaccgacgatacgactaatttcactttcattgatgagtatgaacatgacgttga
K1RL21_BAX-01       ------------------------------------------------------------

K1P6Q7_BAK1-01      acgttctcataaggaccactcagaaagtgtcaataagagaggagacgttgttcaaaatgt
K1RL21_BAX-01       --------------------------------ataggagatgag----------------
                                                    *** **** ***                

K1P6Q7_BAK1-01      tcacacccacaaaattagtcacgttgaacaacataactacaccaatggaaataaatcggg
K1RL21_BAX-01       ------------------------------------cta----gatagaaatgaac----
                                                        ***     ** ***** **     

K1P6Q7_BAK1-01      aatgttgatggagagtgaagtgtgggagtgtaaagatttggctggaaagtctgaacacaa
K1RL21_BAX-01       ---------------------------------------------aaattcagaacctg-
                                                                 *** ** ****    

K1P6Q7_BAK1-01      gcatggagagaggcactccaacatcagggagacaatgcgtccaagacatgcaacatcagg
K1RL21_BAX-01       --gttgaccaagtaaccccaa-----------------gtgcaaaccatgaaacttt---
                       * **   **  ** ****                 ** ***  **** *** *    

K1P6Q7_BAK1-01      acggactagctctgaaaaagaccgtctgtacactgcagttgcagagaagttggcacacat
K1RL21_BAX-01       ------------------------------------------------------------

K1P6Q7_BAK1-01      tggggaccactataaggcaacaagtccactgtctgatagtaccagaagctccgtggataa
K1RL21_BAX-01       ------cttcaatgtggccaacagtttcttttctgatggt--------------------
                          *  * **  *** *  ***    * ****** **                    

K1P6Q7_BAK1-01      cactgcgactaggagagctagtgccagaaccccaaacctaccgggagtggacgaaagagg
K1RL21_BAX-01       ------------------------------------------------------------

K1P6Q7_BAK1-01      cagtgatggattgacagcgcttgaaagacaactgattgactctctaagagaagtggggga
K1RL21_BAX-01       ------------------gttt-----acaactg-------------gggcagagtggga
                                      * **     *******             * * ** * ****

K1P6Q7_BAK1-01      t-tcttttcagcttaaattatctccgaacgctgtcaaggaaattgtaaagcaggccatgt
K1RL21_BAX-01       tgtctattctactt-----------------tgcctacaaaatggcagtaaaggccttga
                    * *** ***  ***                 ** * *  **** * *    ***** ** 

K1P6Q7_BAK1-01      accaaaggttccaggaagtggtcgacaaaaagaccggtcctggcaacagctgggaccata
K1RL21_BAX-01       gtaaaa------------------------------------------------------

K1P6Q7_BAK1-01      ttgccgccgtgttctacctgaccaagaaagttgtcaccatggcgggagtgggcagagccg
K1RL21_BAX-01       ------------ttaatttgatcaga---------tctatag------------------
                                *  *  *** **            * ** *                  

K1P6Q7_BAK1-01      ttgcactgcaggtgaaagatttggcagcggaatacgtggccgataagtttgccacatgga
K1RL21_BAX-01       -tgaactg--ggtggtgaactttatcacagactacgtggccggc------------tgga
                     ** ****  ****    * **     * ** **********              ****

K1P6Q7_BAK1-01      ttgtggatcagggtggttggggtgatcttggacagatggcttactgggacggtggttcgg
K1RL21_BAX-01       tcatagatcgagggggatgggatg------------------------------------
                    *  * ****  ** ** **** **                                    

K1P6Q7_BAK1-01      ggacacggggagggggaagggtccctccttcctcagacgtccgccagatcccctctccct
K1RL21_BAX-01       --------------------------------------------------------ccat
                                                                            ** *

K1P6Q7_BAK1-01      cagaacaaatgacgcccgacactgaggagaatgtcattgatgaggcggaggacgtgatca
K1RL21_BAX-01       cata--------------------------------------------------------
                    ** *                                                        

K1P6Q7_BAK1-01      ggaactttatatttgagagttatcagcatcaacttgttgaggaggtggacactctggatt
K1RL21_BAX-01       ----------------------------------------------gaatactttggg--
                                                                  * * *** ***   

K1P6Q7_BAK1-01      ccaccacccctcaggtcccagagctgtgtgccttcacgtccgatcccatgagtcgagctt
K1RL21_BAX-01       -----accccacag----------------------------------------------
                         ***** ***                                              

K1P6Q7_BAK1-01      cacaagttggtcggcagctggctaggattggagatgacataaataggcgatatgccgatg
K1RL21_BAX-01       ------------------------------------------------------------

K1P6Q7_BAK1-01      aattcaaagacatgattaatcagctgaatgtgaatgaagatacggcttatgaagtgttcg
K1RL21_BAX-01       -----------------aatca---------------------------------gtttt
                                     *****                                 ***  

K1P6Q7_BAK1-01      ctggagttgccaaaaagttgtttgcagatgaaataaactgggggcgggtggcagctttaa
K1RL21_BAX-01       ttggagtcgtcg------------------------------------------------
                     ****** * *                                                 

K1P6Q7_BAK1-01      tgtgcctagcgtaccgtatcaccatgactgttgtcaaggagaaagccaaaaagttcgctc
K1RL21_BAX-01       --------------------------------gcctaggaataa---------------c
                                                    * * ****  **               *

K1P6Q7_BAK1-01      agttcatgaaggtcattgtcagtcatgttgttcgattcatcaaagagaaaatagccgggt
K1RL21_BAX-01       agtttgtgctggcc----------------------------------------------
                    ****  **  ** *                                              

K1P6Q7_BAK1-01      ggattgcaagtcaagggggatggagtgcagccctccagtattccccctccatgagtttta
K1RL21_BAX-01       --------------------------------------------------------ttta

K1P6Q7_BAK1-01      cctccctctccattgttgtggggtcgtgcgtggcggccattgctgctgtgttctacttca
K1RL21_BAX-01       cctt--------------------------tggaaggcact-------------------
                    ***                           ***  * ** *                   

K1P6Q7_BAK1-01      gcaaaaagagttga
K1RL21_BAX-01       -caaa------taa
                     ****      * *

© 1998-2019