Dataset for CDS BAX-like of Organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5JHM2_BAX-05       atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A2K5JHM2_BAX-03       atggacgggtccggggagcagcccag--------aggcgggg--------
A0A2K5JHM2_BAX-04       atggacgggtccggggagcagcccag--------aggcgggggagtgac-
A0A2K5JHM2_BAX-01       atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A2K5JHM2_BAX-02       atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A2K5I0T0_BOK-01       cccactggctgc--------ccccactgtctccaaggtctggactgcaga
A0A2K5IYH0_BAK1-02      ----atggcttcgggacaaggcccaggtcctcccagg-caggaatgcgga
A0A2K5IYH0_BAK1-01      ----atggcttcgggacaaggcccaggtcctcccagg-caggaatgcgga
                              ** * *         ****         ***   **        

A0A2K5JHM2_BAX-05       agctctgagcagatcatgaagacaggggcccttttgcttcagggtttcat
A0A2K5JHM2_BAX-03       --------------------------------tttcatccagg-------
A0A2K5JHM2_BAX-04       -accccgttctgattct----------gcaccctcactccatc-------
A0A2K5JHM2_BAX-01       agctctgagcagatcatgaagacaggggcccttttgcttcagggtttcat
A0A2K5JHM2_BAX-02       agctctgagcagatcatgaagacaggggcccttttgcttcagg-------
A0A2K5I0T0_BOK-01       ggttgggacca----------------gcctctctgtgtctgtccagtcc
A0A2K5IYH0_BAK1-02      gagcctgccct----------------gcc-ctctgcttctg--------
A0A2K5IYH0_BAK1-01      gagcctgccct----------------gcc-ctctgcttctg--------

A0A2K5JHM2_BAX-05       ccaggatcgagcagggcgaatgggcggggagacgcccgagctggccctgg
A0A2K5JHM2_BAX-03       -----atcgagcagggcgaatg-----------------gctggccctgg
A0A2K5JHM2_BAX-04       -----cccactctaggcgaatgggcggggagacgcccgagctggccctgg
A0A2K5JHM2_BAX-01       ccaggatcgagcagggcgaatgggcggggagacgcccgagctggccctgg
A0A2K5JHM2_BAX-02       --------------------------------------------------
A0A2K5I0T0_BOK-01       cctcaccacagctgggct-----gccgggatgagctggagatgatccggc
A0A2K5IYH0_BAK1-02      ------aggagcaggtag-----cccgggacacagaggaggttttccgca
A0A2K5IYH0_BAK1-01      ------aggagcaggtag-----cccgggacacagaggaggttttccgca

A0A2K5JHM2_BAX-05       acccagtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaag
A0A2K5JHM2_BAX-03       acccagtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaag
A0A2K5JHM2_BAX-04       acccagtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaag
A0A2K5JHM2_BAX-01       acccagtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaag
A0A2K5JHM2_BAX-02       --------------------------------------------------
A0A2K5I0T0_BOK-01       ccagcg---tcta--------ccgcaacgtggct----------------
A0A2K5IYH0_BAK1-02      gctacgtttttta--------ccgc-------------------------
A0A2K5IYH0_BAK1-01      gctacgtttttta--------ccgc-------------------------

A0A2K5JHM2_BAX-05       cgcatcggggacgaactggacagtaacatggagctgcagaggatgattgc
A0A2K5JHM2_BAX-03       cgcatcggggacgaactggacagtaacatggagctgcagaggatgattgc
A0A2K5JHM2_BAX-04       cgcatcggggacgaactggacagtaacatggagctgcagaggatgattgc
A0A2K5JHM2_BAX-01       cgcatcggggacgaactggacagtaacatggagctgcagaggatgattgc
A0A2K5JHM2_BAX-02       ----------------------------------------ggatgattgc
A0A2K5I0T0_BOK-01       --cgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatg--
A0A2K5IYH0_BAK1-02      --catcagcagga---------acag---gaggctgaaggggcggctgcc
A0A2K5IYH0_BAK1-01      --catcagcagga---------acag---gaggctgaaggggcggctgcc
                                                                *   * *   

A0A2K5JHM2_BAX-05       cgccgtggacacagactccccccgagaggtctttttccgagtggcagctg
A0A2K5JHM2_BAX-03       cgccgtggacacagactccccccgagaggtctttttccgagtggcagctg
A0A2K5JHM2_BAX-04       cgccgtggacacagactccccccgagaggtctttttccgagtggcagctg
A0A2K5JHM2_BAX-01       cgccgtggacacagactccccccgagaggtctttttccgagtggcagctg
A0A2K5JHM2_BAX-02       cgccgtggacacagactccccccgagaggtctttttccgagtggcagctg
A0A2K5I0T0_BOK-01       cg--------------------------------ttcctggccgtggctg
A0A2K5IYH0_BAK1-02      cc--------------------------------tgccgacccagagatg
A0A2K5IYH0_BAK1-01      cc--------------------------------tgccgacccagagatg
                        *                                 * **        * **

A0A2K5JHM2_BAX-05       ---acatgttttctgac----ggcaacttcaactggggccgtgttgtcgc
A0A2K5JHM2_BAX-03       ---acatgttttctgac----ggcaacttcaactggggccgtgttgtcgc
A0A2K5JHM2_BAX-04       ---acatgttttctgac----ggcaacttcaactggggccgtgttgtcgc
A0A2K5JHM2_BAX-01       ---acatgttttctgac----ggcaacttcaactggggccgtgttgtcgc
A0A2K5JHM2_BAX-02       ---acatgttttctgac----ggcaacttcaactggggccgtgttgtcgc
A0A2K5I0T0_BOK-01       gccacatcttctctgca----ggcatca-cg--tggggcaaggtggt-gt
A0A2K5IYH0_BAK1-02      gtcaccttgcccctgcaacctagcagcacca--tggggc-aggtggg-ac
A0A2K5IYH0_BAK1-01      gtcaccttgcccctgcaacctagcagcacca--tggggc-aggtggg-ac
                           ** *     ***       *** *  *   ******   ** *    

A0A2K5JHM2_BAX-05       ccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
A0A2K5JHM2_BAX-03       ccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
A0A2K5JHM2_BAX-04       ccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
A0A2K5JHM2_BAX-01       ccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
A0A2K5JHM2_BAX-02       ccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
A0A2K5I0T0_BOK-01       ccctgtatgcggtggccgcagg-gctggccgtggactgtgtgaggcagg-
A0A2K5IYH0_BAK1-02      ggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagag
A0A2K5IYH0_BAK1-01      ggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagag
                                 *  *    *          *    * *  * **   **   

A0A2K5JHM2_BAX-05       tgcccgaactgatcagaaccatcatgggctggacac---tggacttcctc
A0A2K5JHM2_BAX-03       tgcccgaactgatcagaaccatcatgggctggacac---tggacttcctc
A0A2K5JHM2_BAX-04       tgcccgaactgatcagaaccatcatgggctggacac---tggacttcctc
A0A2K5JHM2_BAX-01       tgcccgaactgatcagaaccatcatgggctggacac---tggacttcctc
A0A2K5JHM2_BAX-02       tgcccgaactgatcagaaccatcatgggctggacac---tggacttcctc
A0A2K5I0T0_BOK-01       -cccag-----------cctgccatggtccacgccctcgtggactgc--c
A0A2K5IYH0_BAK1-02      ttccag--------------accatgctgca-gcacctgcagcccacggc
A0A2K5IYH0_BAK1-01      ttccag--------------accatgctgca-gcacctgcagcccacggc
                          ** *                ****       * *     * *  *  *

A0A2K5JHM2_BAX-05       cgggagcggctgttgggctggatccaagac--------------------
A0A2K5JHM2_BAX-03       cgggagcggctgttgggctggatccaagac--------------------
A0A2K5JHM2_BAX-04       cgggagcggctgttgggctggatccaagac--------------------
A0A2K5JHM2_BAX-01       cgggagcggctgttgggctggatccaagac--------------------
A0A2K5JHM2_BAX-02       cgggagcggctgttgggctggatccaagac--------------------
A0A2K5I0T0_BOK-01       tgggggagtttgtgcg--------caaga----ccctgg-----------
A0A2K5IYH0_BAK1-02      agagaacgcctatgagtacttcaccaagattgcctccaggccagcagcaa
A0A2K5IYH0_BAK1-01      agagaacgcctatgagtacttcaccaagattgcctc--------------
                         * *   *  * *  *        *****                     

A0A2K5JHM2_BAX-05       ------cagggtggttg---------------------------------
A0A2K5JHM2_BAX-03       ------cagggtggttgggggctgcccctggctgagtcgctgaagcgact
A0A2K5JHM2_BAX-04       ------cagggtggttg---------------------------------
A0A2K5JHM2_BAX-01       ------cagggtggttg---------------------------------
A0A2K5JHM2_BAX-02       ------cagggtggttg---------------------------------
A0A2K5I0T0_BOK-01       ------caacctggctgcggagacgtggc---------------------
A0A2K5IYH0_BAK1-02      cacccacagcctgtttgaga----gtggc---------------------
A0A2K5IYH0_BAK1-01      ------cagcctgtttgaga----gtggc---------------------
                              **   **  **                                 

A0A2K5JHM2_BAX-05       ----------------ggtgagactcctcaaccctcct------caccc-
A0A2K5JHM2_BAX-03       gctgtccctgtctccaggacggcctcctc--tcctactttgggacgccc-
A0A2K5JHM2_BAX-04       ----------------ggacggcctcctc--tcctactttgggacgccc-
A0A2K5JHM2_BAX-01       ----------------ggacggcctcctc--tcctactttgggacgccc-
A0A2K5JHM2_BAX-02       ----------------ggacggcctcctc--tcctactttgggacgccc-
A0A2K5I0T0_BOK-01       ----------------ggatggact-----------------gatgtcct
A0A2K5IYH0_BAK1-02      ------------------atcaact-----------------ggggcc--
A0A2K5IYH0_BAK1-01      ------------------atcaact-----------------ggggcc--
                                               **                      *  

A0A2K5JHM2_BAX-05       -----caaccaccgcccctgccccactgtcccttggtg------------
A0A2K5JHM2_BAX-03       -----acgtggcagaccgtgacc------atcttggtggctggagtactc
A0A2K5JHM2_BAX-04       -----acgtggcagaccgtgacc------atcttggtggctggagtactc
A0A2K5JHM2_BAX-01       -----acgtggcagaccgtgacc------atcttggtggctggagtactc
A0A2K5JHM2_BAX-02       -----acgtggcagaccgtgacc------atcttggtggctggagtactc
A0A2K5I0T0_BOK-01       caaatgtgtggtcagcacagacc--------ct----ggcctccgctccc
A0A2K5IYH0_BAK1-02      -----gtgtggt-------ggct--------cttctgggcttcggct---
A0A2K5IYH0_BAK1-01      -----gtgtggt-------ggct--------cttctgggcttcggct---
                                           * *         **    *            

A0A2K5JHM2_BAX-05       -----cc--------ctctccccatcttcggatcatcagatgtggt----
A0A2K5JHM2_BAX-03       actgcct--------cgctcaccatct--gga--agaagatgggctgagg
A0A2K5JHM2_BAX-04       actgcct--------cgctcaccatct--gga--agaagatgggctga--
A0A2K5JHM2_BAX-01       actgcct--------cgctcaccatct--gga--agaagatgggctga--
A0A2K5JHM2_BAX-02       actgcct--------cgctcaccatct--gga--agaagatgggctga--
A0A2K5I0T0_BOK-01       actggctggtagccgcactgtgcagcttcggc------cgcttcctga--
A0A2K5IYH0_BAK1-02      accgtctg------gccctacacgtctaccag------cgcggcctga--
A0A2K5IYH0_BAK1-01      accgtctg------gccctacacgtctaccag------cgcggcctgact
                             *         * **   *  **                  *    

A0A2K5JHM2_BAX-05       -----------ctataacgcgtttccttacgtgtct--------------
A0A2K5JHM2_BAX-03       cccccagctgccttgaactgtgtttttcctccataa--------------
A0A2K5JHM2_BAX-04       --------------------------------------------------
A0A2K5JHM2_BAX-01       --------------------------------------------------
A0A2K5JHM2_BAX-02       --------------------------------------------------
A0A2K5I0T0_BOK-01       -------------aggctgccttcttcgtgctg-----------------
A0A2K5IYH0_BAK1-02      --------------------------------------------------
A0A2K5IYH0_BAK1-01      ggcttcctgggccaggtgacccgcttcgtggtggacttcatgctgcatca

A0A2K5JHM2_BAX-05       --------------------------------------------------
A0A2K5JHM2_BAX-03       --------------------------------------------------
A0A2K5JHM2_BAX-04       --------------------------------------------------
A0A2K5JHM2_BAX-01       --------------------------------------------------
A0A2K5JHM2_BAX-02       --------------------------------------------------
A0A2K5I0T0_BOK-01       --------------------------------------------------
A0A2K5IYH0_BAK1-02      --------------------------------------------------
A0A2K5IYH0_BAK1-01      ctgcattgcccggtggattgcacagaggggtggctgggtggcagccctga

A0A2K5JHM2_BAX-05       --------------------------------------------------
A0A2K5JHM2_BAX-03       --------------------------------------------------
A0A2K5JHM2_BAX-04       --------------------------------------------------
A0A2K5JHM2_BAX-01       --------------------------------------------------
A0A2K5JHM2_BAX-02       --------------------------------------------------
A0A2K5I0T0_BOK-01       --------------------------------------------------
A0A2K5IYH0_BAK1-02      --------------------------------------------------
A0A2K5IYH0_BAK1-01      acttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggtt

A0A2K5JHM2_BAX-05       ------------------------------------------
A0A2K5JHM2_BAX-03       ------------------------------------------
A0A2K5JHM2_BAX-04       ------------------------------------------
A0A2K5JHM2_BAX-01       ------------------------------------------
A0A2K5JHM2_BAX-02       ------------------------------------------
A0A2K5I0T0_BOK-01       ---------------------------ctgccagagagatga
A0A2K5IYH0_BAK1-02      ------------------------------------------
A0A2K5IYH0_BAK1-01      ctgttgggccagtttgtggtacgaagattcttcaaatcatga

© 1998-2019