Dataset for CDS BAX of Organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5JHM2_BAX-05      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K5JHM2_BAX-03      atggacgggtccggggagcagcccagaggcgggg----------------
A0A2K5JHM2_BAX-04      atggacgggtccggggagcagcccagaggcgggggagtgac--accccgt
A0A2K5JHM2_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K5JHM2_BAX-02      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       **********************************                

A0A2K5JHM2_BAX-05      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K5JHM2_BAX-03      ------------------------tttcatccagg------------atc
A0A2K5JHM2_BAX-04      tctgattct----------gcaccctcactccatc------------ccc
A0A2K5JHM2_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K5JHM2_BAX-02      gcagatcatgaagacaggggcccttttgcttcagg---------------
                                                *   * **                 

A0A2K5JHM2_BAX-05      gagcagggcgaatgggcggggagacgcccgagctggccctggacccagtg
A0A2K5JHM2_BAX-03      gagcagggcgaatg-----------------gctggccctggacccagtg
A0A2K5JHM2_BAX-04      actctaggcgaatgggcggggagacgcccgagctggccctggacccagtg
A0A2K5JHM2_BAX-01      gagcagggcgaatgggcggggagacgcccgagctggccctggacccagtg
A0A2K5JHM2_BAX-02      --------------------------------------------------
                                                                         

A0A2K5JHM2_BAX-05      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5JHM2_BAX-03      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5JHM2_BAX-04      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5JHM2_BAX-01      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5JHM2_BAX-02      --------------------------------------------------
                                                                         

A0A2K5JHM2_BAX-05      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5JHM2_BAX-03      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5JHM2_BAX-04      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5JHM2_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5JHM2_BAX-02      --------------------------------ggatgattgccgccgtgg
                                                       ******************

A0A2K5JHM2_BAX-05      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5JHM2_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5JHM2_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5JHM2_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5JHM2_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                       **************************************************

A0A2K5JHM2_BAX-05      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5JHM2_BAX-03      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5JHM2_BAX-04      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5JHM2_BAX-01      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5JHM2_BAX-02      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
                       **************************************************

A0A2K5JHM2_BAX-05      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5JHM2_BAX-03      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5JHM2_BAX-04      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5JHM2_BAX-01      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5JHM2_BAX-02      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
                       **************************************************

A0A2K5JHM2_BAX-05      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K5JHM2_BAX-03      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K5JHM2_BAX-04      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K5JHM2_BAX-01      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K5JHM2_BAX-02      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
                       **************************************************

A0A2K5JHM2_BAX-05      tggatccaagaccagggtggttg---------------------------
A0A2K5JHM2_BAX-03      tggatccaagaccagggtggttgggggctgcccctggctgagtcgctgaa
A0A2K5JHM2_BAX-04      tggatccaagaccagggtggttg---------------------------
A0A2K5JHM2_BAX-01      tggatccaagaccagggtggttg---------------------------
A0A2K5JHM2_BAX-02      tggatccaagaccagggtggttg---------------------------
                       ***********************                           

A0A2K5JHM2_BAX-05      ----------------------ggtgagactcctcaaccctcct------
A0A2K5JHM2_BAX-03      gcgactgctgtccctgtctccaggacggcctcctc--tcctactttggga
A0A2K5JHM2_BAX-04      ----------------------ggacggcctcctc--tcctactttggga
A0A2K5JHM2_BAX-01      ----------------------ggacggcctcctc--tcctactttggga
A0A2K5JHM2_BAX-02      ----------------------ggacggcctcctc--tcctactttggga
                                             **   * ******   *** **      

A0A2K5JHM2_BAX-05      caccccaaccaccgcccctgccccactgtcccttggtg------------
A0A2K5JHM2_BAX-03      cgcccacgtggcagaccgtgacc------atcttggtggctggagtactc
A0A2K5JHM2_BAX-04      cgcccacgtggcagaccgtgacc------atcttggtggctggagtactc
A0A2K5JHM2_BAX-01      cgcccacgtggcagaccgtgacc------atcttggtggctggagtactc
A0A2K5JHM2_BAX-02      cgcccacgtggcagaccgtgacc------atcttggtggctggagtactc
                       * ***      * * ** ** **        *******            

A0A2K5JHM2_BAX-05      -----ccctctccccatcttcggatcatcagatgtggt------------
A0A2K5JHM2_BAX-03      actgcctcgctcaccatct--gga--agaagatgggctgaggcccccagc
A0A2K5JHM2_BAX-04      actgcctcgctcaccatct--gga--agaagatgggctga----------
A0A2K5JHM2_BAX-01      actgcctcgctcaccatct--gga--agaagatgggctga----------
A0A2K5JHM2_BAX-02      actgcctcgctcaccatct--gga--agaagatgggctga----------
                            * * *** ******  ***  *  ***** * *            

A0A2K5JHM2_BAX-05      ---ctataacgcgtttccttacgtgtct
A0A2K5JHM2_BAX-03      tgccttgaactgtgtttttcctccataa
A0A2K5JHM2_BAX-04      ----------------------------
A0A2K5JHM2_BAX-01      ----------------------------
A0A2K5JHM2_BAX-02      ----------------------------
                                                   

© 1998-2018