Dataset for CDS BAX-like of Organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5L9Q9_BOK-01       atgga-ggtgctgcggcgctcctcgg-tcttcgccgccgagatcatggat
A0A2K5KU58_BAX-04       atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A2K5KU58_BAX-03       atggacgggtccggggagcagcccag--------aggcgggggtgaggcg
A0A2K5KU58_BAX-01       atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A2K5KU58_BAX-02       atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A2K5N1M7_BAK1-02      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
A0A2K5N1M7_BAK1-01      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
A0A2K5KTQ1_BAK1-01      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcggag
A0A2K5KTQ1_BAK1-02      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcggag
A0A2K5KTQ1_BAK1-03      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcggag
                            * **      *      * * *         * *  *         

A0A2K5L9Q9_BOK-01       gcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggc
A0A2K5KU58_BAX-04       agctc---------------------tgagcagatcatgaag-----aca
A0A2K5KU58_BAX-03       gg-------------------------aggcagac-----gg-----gcg
A0A2K5KU58_BAX-01       agctc---------------------tgagcagatcatgaag-----aca
A0A2K5KU58_BAX-02       agctc---------------------tgagcagatcatgaag-----aca
A0A2K5N1M7_BAK1-02      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
A0A2K5N1M7_BAK1-01      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
A0A2K5KTQ1_BAK1-01      agcttgccctgccc-tctgcttctgaggagcaggtaacccgggacatgga
A0A2K5KTQ1_BAK1-02      agcttgccctgccc-tctgcttctgaggagcaggtaacccgggacatgga
A0A2K5KTQ1_BAK1-03      agcttgccctgccc-tctgcttctgaggagcaggtaacccgggacatgga
                                                     ** *        *        

A0A2K5L9Q9_BOK-01       gctg------------------------ggccgggagtacgtgcacgcgc
A0A2K5KU58_BAX-04       ggggcccttttgcttcagggtttcatccaggatcgagcag----------
A0A2K5KU58_BAX-03       ggag------------gaggtttcatccaggatcgagcag----------
A0A2K5KU58_BAX-01       ggggcccttttgcttcagggtttcatccaggatcgagcag----------
A0A2K5KU58_BAX-02       ggggcccttttgcttcagg-------------------------------
A0A2K5N1M7_BAK1-02      ggaggttttccgcagctacgttttttaccgccatcagcaggaaca-----
A0A2K5N1M7_BAK1-01      ggaggttttccgcagctacgttttttaccgccatcagcaggaaca-----
A0A2K5KTQ1_BAK1-01      gaag---------------gtttttgaccgccatcagcaagaaca-----
A0A2K5KTQ1_BAK1-02      gaag---------------gtttttgaccgccatcagcaagaaca-----
A0A2K5KTQ1_BAK1-03      gaag---------------gtttttgaccgccatcagcaagaaca-----
                        *  *                                              

A0A2K5L9Q9_BOK-01       ggctactg----------cgcgccggcctctcctggagcgcgcccgagcg
A0A2K5KU58_BAX-04       ggcgaatggggggggagacacccgagctggccctggacccggtgc---ct
A0A2K5KU58_BAX-03       ggcgaatggggggggagacacccgagctggccctggacccggtgc---ct
A0A2K5KU58_BAX-01       ggcgaatggggggggagacacccgagctggccctggacccggtgc---ct
A0A2K5KU58_BAX-02       --------------------------------------------------
A0A2K5N1M7_BAK1-02      ggaggctgaaggggcggctgcccctgctgatccagagatggacac---ct
A0A2K5N1M7_BAK1-01      ggaggctgaaggggcggctgcccctgctgatccagagatggacac---ct
A0A2K5KTQ1_BAK1-01      ggaggctgaagggccagccgcccctgccgacccagagatggtcac---ct
A0A2K5KTQ1_BAK1-02      ggaggctgaagggccagccgcccctgccgacccagagatggtcac---ct
A0A2K5KTQ1_BAK1-03      ggaggctgaag---------------------------------------

A0A2K5L9Q9_BOK-01       cgccgcgcctgtcccgggacgcc-tggccgaggtgtgcgcggtgctcctg
A0A2K5KU58_BAX-04       --------caggatgcgtccaccaagaggc---tgagcgagtgtctcaag
A0A2K5KU58_BAX-03       --------caggatgcgtccaccaagaggc---tgagcgagtgtctcaag
A0A2K5KU58_BAX-01       --------caggatgcgtccaccaagaggc---tgagcgagtgtctcaag
A0A2K5KU58_BAX-02       --------------------------------------------------
A0A2K5N1M7_BAK1-02      tgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgcc
A0A2K5N1M7_BAK1-01      tgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgcc
A0A2K5KTQ1_BAK1-01      tgcccctccaacctagcagcaccgtggggcaggtgggacggcagatc---
A0A2K5KTQ1_BAK1-02      tgcccctccaacctagcagcaccgtggggcaggtgggacggcagatc---
A0A2K5KTQ1_BAK1-03      ---------------gcagcaccgtggggcaggtgggacggcagatc---

A0A2K5L9Q9_BOK-01       cgcctgggggatgagctggagatgatccggcccagcgtctaccgaaacgt
A0A2K5KU58_BAX-04       cgcatcggggacgaactggacagt---------------------aacat
A0A2K5KU58_BAX-03       cgcatcggggacgaactggacagt---------------------aacat
A0A2K5KU58_BAX-01       cgcatcggggacgaactggacagt---------------------aacat
A0A2K5KU58_BAX-02       --------------------------------------------------
A0A2K5N1M7_BAK1-02      atcatcggggacgacatcaaccgacgctatgactcagagttccagaccat
A0A2K5N1M7_BAK1-01      atcatcggggacgacatcaaccgacgctatgactcagagttccagaccat
A0A2K5KTQ1_BAK1-01      ---------------------------------------------accat
A0A2K5KTQ1_BAK1-02      ---------------------------------------------accat
A0A2K5KTQ1_BAK1-03      ---------------------------------------------accat

A0A2K5L9Q9_BOK-01       ggctcgtcagctgca----catctccctgcagtctgaacctgtggtgacc
A0A2K5KU58_BAX-04       g------gagctgcagaggatgattgccgccgtggaca-cagactccccc
A0A2K5KU58_BAX-03       g------gagctgcagaggatgattgccgccgtggaca-cagactccccc
A0A2K5KU58_BAX-01       g------gagctgcagaggatgattgccgccgtggaca-cagactccccc
A0A2K5KU58_BAX-02       -----------------ggatgattgccgccgtggaca-cagactccccc
A0A2K5N1M7_BAK1-02      g------ctgcagca----------gctgcagcccacggcagagaacgcc
A0A2K5N1M7_BAK1-01      g------ctgcagca----------gctgcagcccacggcagagaacgcc
A0A2K5KTQ1_BAK1-01      g------ctgcagca----------cctgcagcgcacagcagagaacgcc
A0A2K5KTQ1_BAK1-02      g------ctgcagca----------cctgcagcgcacagcagagaacgcc
A0A2K5KTQ1_BAK1-03      g------ctgcagca----------cctgcagcgcacagcagagaacgcc
                                                  * ** *       * *      **

A0A2K5L9Q9_BOK-01       gatgcgttcctggcc---gtggctgg--------------------ccac
A0A2K5KU58_BAX-04       cgagaggtctttttccgagtggcagc--------------------tgac
A0A2K5KU58_BAX-03       cgagaggtctttttccgagtggcagc--------------------tgac
A0A2K5KU58_BAX-01       cgagaggtctttttccgagtggcagc--------------------tgac
A0A2K5KU58_BAX-02       cgagaggtctttttccgagtggcagc--------------------tgac
A0A2K5N1M7_BAK1-02      tatgagtacttcaccaagattgcctccaggccagcagcaacacccacagc
A0A2K5N1M7_BAK1-01      tatgagtacttcaccaagattgcctc--------------------cagc
A0A2K5KTQ1_BAK1-01      tacgagtacttcaccaagatcgcctc--------------------cagc
A0A2K5KTQ1_BAK1-02      tacgagtacttcaccaagatcgcctc--------------------cagc
A0A2K5KTQ1_BAK1-03      tacgagtacttcaccaagatcgcctc--------------------cagc
                           * *  * *   *    * **                          *

A0A2K5L9Q9_BOK-01       atcttctctgcagg---catcacgtggggcaaggtggtgtccctgtatgc
A0A2K5KU58_BAX-04       atgttttctgacggcaacttcaactggggccgtgttgtcgccct------
A0A2K5KU58_BAX-03       atgttttctgacggcaacttcaactggggccgtgttgtcgccct------
A0A2K5KU58_BAX-01       atgttttctgacggcaacttcaactggggccgtgttgtcgccct------
A0A2K5KU58_BAX-02       atgttttctgacggcaacttcaactggggccgtgttgtcgccct------
A0A2K5N1M7_BAK1-02      ctgtt---tgagagtggcatcaactggggccgtgtggtggctct------
A0A2K5N1M7_BAK1-01      ctgtt---tgagagtggcatcaactggggccgtgtggtggctct------
A0A2K5KTQ1_BAK1-01      ctgtt---tgagagtggcatcaaccagggccgtgtggtggctct------
A0A2K5KTQ1_BAK1-02      ctgtt---tgagagtggcatcaaccagggccgtgtggtggctct------
A0A2K5KTQ1_BAK1-03      ctgtt---tgagagtggcatcaaccagggccgtgtggtggctct------
                         * **   **   *   * ***    ****   ** **  * **      

A0A2K5L9Q9_BOK-01       ggtggccgcggggctggctgtggactgtgtgaggcaggcccagcctgcca
A0A2K5KU58_BAX-04       -----tttctactttgccagcaaactg-gtgctcaaggccctgtgtacca
A0A2K5KU58_BAX-03       -----tttctactttgccagcaaactg-gtgctcaaggccctgtgtacca
A0A2K5KU58_BAX-01       -----tttctactttgccagcaaactg-gtgctcaaggccctgtgtacca
A0A2K5KU58_BAX-02       -----tttctactttgccagcaaactg-gtgctcaaggccctgtgtacca
A0A2K5N1M7_BAK1-02      -----tctgggcttcggctaccgtctg-gccct-----acacgtctacca
A0A2K5N1M7_BAK1-01      -----tctgggcttcggctaccgtctg-gccct-----acacgtctacca
A0A2K5KTQ1_BAK1-01      -----cctgggcttcagctaccatctg-gtcct-----acatgtctacca
A0A2K5KTQ1_BAK1-02      -----cctgggcttcagctaccatctg-gtcct-----acatgtctacca
A0A2K5KTQ1_BAK1-03      -----cctgggcttcagctaccatctg-gtcct-----acatgtctacca
                                         *      *** *          *  *  * ***

A0A2K5L9Q9_BOK-01       ------------tggtccacgccctcgtggactgtctgggggagtttgtg
A0A2K5KU58_BAX-04       aggtgcccgaactgatcagaaccatcatgggctggacactggacttcctc
A0A2K5KU58_BAX-03       aggtgcccgaactgatcagaaccatcatgggctggacactggacttcctc
A0A2K5KU58_BAX-01       aggtgcccgaactgatcagaaccatcatgggctggacactggacttcctc
A0A2K5KU58_BAX-02       aggtgcccgaactgatcagaaccatcatgggctggacactggacttcctc
A0A2K5N1M7_BAK1-02      gcacggcctga---------------------------------------
A0A2K5N1M7_BAK1-01      gcacggcctgactgg-------cttcctgggccaggt----gacccgctt
A0A2K5KTQ1_BAK1-01      gcgcggcttgactgg-------cttcctgggccaggt----gacccgctt
A0A2K5KTQ1_BAK1-02      gcgcggcttgactgg-------cttcctgggccaggt----gacccgctt
A0A2K5KTQ1_BAK1-03      gcgcggcttgactgg-------cttcctgggccaggt----gacccgctt

A0A2K5L9Q9_BOK-01       cgcaagacgctggcaa-------------------cctggctgcggagac
A0A2K5KU58_BAX-04       cgggagcggctgttgg-------------------gctggatccaagacc
A0A2K5KU58_BAX-03       cgggagcggctgttgg-------------------gctggatccaagacc
A0A2K5KU58_BAX-01       cgggagcggctgttgg-------------------gctggatccaagacc
A0A2K5KU58_BAX-02       cgggagcggctgttgg-------------------gctggatccaagacc
A0A2K5N1M7_BAK1-02      --------------------------------------------------
A0A2K5N1M7_BAK1-01      cgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacaga
A0A2K5KTQ1_BAK1-01      cgtggt---cttcatgctgcaacactgcatcgcctggtggatcgcgcaga
A0A2K5KTQ1_BAK1-02      cgtggt---cttcatgctgcaacactgcatcgcctggtggatcgcgcaga
A0A2K5KTQ1_BAK1-03      cgtggt---cttcatgctgcaacactgcatcgcctggtggatcgcgcaga

A0A2K5L9Q9_BOK-01       gcggcggatggactgatgtcctcaagtgtgtggtcag----------cac
A0A2K5KU58_BAX-04       agggtggttgggtgagactcctcaaccctccc------caccccaaccac
A0A2K5KU58_BAX-03       agggtggttgggacggcctcct--gtcctactttgggacacccacgtggc
A0A2K5KU58_BAX-01       agggtggttgggacggcctcct--gtcctactttgggacacccacgtggc
A0A2K5KU58_BAX-02       agggtggttgggacggcctcct--gtcctactttgggacacccacgtggc
A0A2K5N1M7_BAK1-02      --------------------------------------------------
A0A2K5N1M7_BAK1-01      ggggtggctgggtggcagccct--gaacttgggcaatggtcccatcctga
A0A2K5KTQ1_BAK1-01      ggggcagctgggt----gtctt--tgcctt---ctctgctcccgtgc---
A0A2K5KTQ1_BAK1-02      ggggcagctgggtggcagccct--ggacttgggcaatggtcccatcctga
A0A2K5KTQ1_BAK1-03      ggggcagctgggtggcagccct--ggacttgggcaatggtcccatcctga

A0A2K5L9Q9_BOK-01       agaccctggcctccgctcccactggctggtagccgcactctgcagcttcg
A0A2K5KU58_BAX-04       cgcccctgccccac-----------t--gtccctg-----------ccca
A0A2K5KU58_BAX-03       agaccgtgaccatc-----------ttggtggctggagt------actca
A0A2K5KU58_BAX-01       agaccgtgaccatc-----------ttggtggctggagt------actca
A0A2K5KU58_BAX-02       agaccgtgaccatc-----------ttggtggctggagt------actca
A0A2K5N1M7_BAK1-02      --------------------------------------------------
A0A2K5N1M7_BAK1-01      acgtgctggtggtt-----------ctgggtgtggttct------gttgg
A0A2K5KTQ1_BAK1-01      ---------------------------aggggt----------------t
A0A2K5KTQ1_BAK1-02      acatgctggtgatt-----------ctgggggtggttct------gttgg
A0A2K5KTQ1_BAK1-03      acatgctggtgatt-----------ctgggggtggttct------gttgg

A0A2K5L9Q9_BOK-01       gccgcttcctgaaggctgccttcttcgtgctgctgccagagag-------
A0A2K5KU58_BAX-04       ccccctgtcacagtggtgccctctccccatctttggatcatcagatgtgg
A0A2K5KU58_BAX-03       ccgcct--------------ccctcaccatc--tgga--agaagatggg-
A0A2K5KU58_BAX-01       ccgcct--------------ccctcaccatc--tgga--agaagatggg-
A0A2K5KU58_BAX-02       ccgcct--------------ccctcaccatc--tgga--agaagatggg-
A0A2K5N1M7_BAK1-02      --------------------------------------------------
A0A2K5N1M7_BAK1-01      gccagtttgtggtacgaagattcttcaaatc-------------------
A0A2K5KTQ1_BAK1-01      gcccttcaaaagcacagaag--ctttag----------------------
A0A2K5KTQ1_BAK1-02      gcccgtttgtggtacaaagattcttcaaatc-------------------
A0A2K5KTQ1_BAK1-03      gcccgtttgtggtacaaagattcttcaaatc-------------------

A0A2K5L9Q9_BOK-01       ---------------atga-------
A0A2K5KU58_BAX-04       tctataatgcatttccttatgtgtct
A0A2K5KU58_BAX-03       ---------------ctga-------
A0A2K5KU58_BAX-01       ---------------ctga-------
A0A2K5KU58_BAX-02       ---------------ctga-------
A0A2K5N1M7_BAK1-02      --------------------------
A0A2K5N1M7_BAK1-01      ---------------atga-------
A0A2K5KTQ1_BAK1-01      --------------------------
A0A2K5KTQ1_BAK1-02      ---------------atga-------
A0A2K5KTQ1_BAK1-03      ---------------atga-------

© 1998-2019