Dataset for CDS BAX-like of Organism Cavia porcellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A286XGM4_BOK-01      gtgagaatcaggttggtggcaatggggttaggtgaag--tcaagt-----
H0UT71_BAK1-01         ---------------------atggcatcagaccaaggcccaggtcctct
                                            ****  * **   ***   ** **     

A0A286XGM4_BOK-01      ---ggagatcagcctggaggtc---------------atggggccccagc
H0UT71_BAK1-01         ccgggagggctgcggaggggcctccccgctgtctgaggaggagcagcagg
                          ****  * **   * ** *                 ** **  *** 

A0A286XGM4_BOK-01      cagcctgg--catgggagctgtctctcactcacatgtgtgt-----ccac
H0UT71_BAK1-01         tggtccgggacaccgaggaagttttccagagctacgtgtaccatcgccac
                         * * **  **  *  *  ** *  **     * ****       ****

A0A286XGM4_BOK-01      cag--------------------gggacgag---ctggagcagatt---c
H0UT71_BAK1-01         cagcaggatagaggagggacacagggccgggtacctcgggcgcatcctac
                       ***                    *** ** *   ** * **  **    *

A0A286XGM4_BOK-01      ggcccagtg--------tgtaccgcaac---------gtggcccgccagc
H0UT71_BAK1-01         tgctcactgctgcttcctgtccagcaccctgacccaggtgggctgccagc
                        ** ** **        *** * *** *         **** * ******

A0A286XGM4_BOK-01      tgcacatctccctgcagtcagagcctgtggtgactgatgcgtttctggct
H0UT71_BAK1-01         tggccatc--------atcggagacgacatcaaccggcgc---tatggca
                       **  ****         ** *** *       ** *  **   * **** 

A0A286XGM4_BOK-01      gtggc----aggccacatcttctcagcag--gcatcacatggggcaaggt
H0UT71_BAK1-01         gtgacattgaagccatg---ctccagcagctgcagcccacggcggacaac
                       *** *    * ****        ******  *** * ** ** * *    

A0A286XGM4_BOK-01      ggtgtccctctactcggtggctgcggggctggctgtggactgtgtgcgac
H0UT71_BAK1-01         g----ccccggacctgtt--ctacaagatcgcctgcagcctgtttaagcc
                       *    ***   **  * *  ** *  *   * ***  * **** *  * *

A0A286XGM4_BOK-01      aggcccagcctg-----ccatgg------ttcatgccctggtcgactgcc
H0UT71_BAK1-01         cggccccacctggggccgcgtggtggctctcctggccttcggctaccgcc
                        *****  ****      * ***      * *  *** * * * ** ***

A0A286XGM4_BOK-01      tgggggagtttgt------gcgaaagaccctggctacctggctg------
H0UT71_BAK1-01         tagccctgcatgtctaccagcagcacggcctgtctggctttctgggcaag
                       * *    *  ***      **   *   **** **  **  ***      

A0A286XGM4_BOK-01      -----------------cggcggcgtggcgga--------tggaccgatg
H0UT71_BAK1-01         gtgaccaggcttgtagtcgacagcatgctgcagttaaacgtggtccggtg
                                        ** * ** **  * *        *** *** **

A0A286XGM4_BOK-01      --tcctgaag---------tgtgtggtcagcaccgatcccagcc------
H0UT71_BAK1-01         gatcgtggagaaaggcggctgggtgg-cagccctggactgggccggaacc
                         ** ** **         ** **** **** * *  *   ***      

A0A286XGM4_BOK-01      -tccactcccactggctcgtggccgcgctgtgcaactttgggcgct-tcc
H0UT71_BAK1-01         ttccgccccatctggactgtggt-------tacagccttcgccattgtca
                        *** * **  ****   ****        * ** * ** * *  * ** 

A0A286XGM4_BOK-01      tgaaggccgcc-----------------ttctttgtgctcttgccagaga
H0UT71_BAK1-01         tggtgg--gccagtatgtgatacgaagattcttcaagtcatcg-------
                       **  **  ***                 *****   *   * *       

A0A286XGM4_BOK-01      gatga
H0UT71_BAK1-01         --tga

© 1998-2019