Dataset for CDS BAX-like of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6PMP8_BAK1-01      atg-----------------gcatccgggcaaggcccagggcctcccaggcggg------
Q52HB2_BAK1-01      atg-----------------gcatccgggcaaggcccagggcctcccaggcggg------
F1PAN9_BAX-01       atgagccaccctagttcgctgggtcc-cctaggacccaag-------agtccaggcacct
F1PAN9_BAX-02       atggac--------------gggtccggggagcaacccag-------aggcggg------
Q8HYU5_BAX-01       atggac--------------gggtccggggagcaacccag-------aggcggg------
                    ***                 *  ***    *    **  *       ** *  *      

F6PMP8_BAK1-01      ------------agtgtggagaggctgccccgtcttctacttctgag--gagcaggtagc
Q52HB2_BAK1-01      ------------agtgtggagaggctgccccgtcttctacttctgag--gagcaggtagc
F1PAN9_BAX-01       cttccctcctttctcctctagggcccacc---------agctctgagcagatcatgaaga
F1PAN9_BAX-02       --------------------gggcccacc---------agctctgagcagatcatgaaga
Q8HYU5_BAX-01       --------------------gggcccacc---------agctctgagcagatcatgaaga
                                        * * *  **         *  ******  ** ** * ** 

F6PMP8_BAK1-01      ccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcagga
Q52HB2_BAK1-01      ccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcagga
F1PAN9_BAX-01       caggggccct-------tttgcttcag----ggtttcatccaagatcgagcagggcgaat
F1PAN9_BAX-02       caggggccct-------tttgcttcag----ggtttcatccaagatcgagcagggcgaat
Q8HYU5_BAX-01       caggggccct-------tttgcttcag----ggtttcatccaagatcgagcagggcgaat
                    * *** * *        *** *  ***    * ***   **   ****    * **    

F6PMP8_BAK1-01      ggctgagggggcggctgtgccagctgacccagaaatggtcaccttgcccctagaacctag
Q52HB2_BAK1-01      ggctgagggggcggctgtgccagctgacccagaaatggtcaccttgcccctagaacctag
F1PAN9_BAX-01       ggggggagagacacctg----agctgcccttggagcaggtg------ccccaggatgcat
F1PAN9_BAX-02       ggggggagagacacctg----agctgcccttggagcaggtg------ccccaggatgcat
Q8HYU5_BAX-01       ggggggagagacacctg----agctgcccttggagcaggtg------ccccaggatgcat
                    **  *  * * *  ***    ***** **  * *   *         *** ** *   * 

F6PMP8_BAK1-01      cagcaccatggggcaggtgggtcggcagctcgctatcattggggacgacatcaaccagcg
Q52HB2_BAK1-01      cagcaccatggggcaggtgggtcggcagctcgctatcattggggacgacatcaaccagcg
F1PAN9_BAX-01       c--caccaagaagc---tgagcgaatgtctcaagcgcatcggagatg------aactgga
F1PAN9_BAX-02       c--caccaagaagc---tgagcgaatgtctcaagcgcatcggagatg------aactgga
Q8HYU5_BAX-01       c--caccaagaagc---tgagcgaatgtctcaagcgcatcggagatg------aactgga
                    *  ***** *  **   ** *       ***     *** ** ** *      * * *  

F6PMP8_BAK1-01      ctatgactcggagttccaggccatgct-gcagcacctacagccgacagcagagaatgcct
Q52HB2_BAK1-01      ctatgactcggagttccaggccatgct-gcagcacctacagccgacagcagagaatgcct
F1PAN9_BAX-01       cagtaacatggagttgcagaggatgatcgcag------ctgtggaca-cagactctcccc
F1PAN9_BAX-02       cagtaacatggagttgcagaggatgatcgcag------ctgtggaca-cagactctcccc
Q8HYU5_BAX-01       cagtaacatggagttgcagaggatgatcgcag------ctgtggaca-cagactctcccc
                    *  * **  ****** ***   *** * ****      * *  **** ****   * ** 

F6PMP8_BAK1-01      atgagtacttcaccaagattgcctc---gagcctatttgagagcggcatcaactggggcc
Q52HB2_BAK1-01      atgagtacttcaccaagattgcctc---gagcctatttgagagcggcatcaactggggcc
F1PAN9_BAX-01       gtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactggggcc
F1PAN9_BAX-02       gtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactggggcc
Q8HYU5_BAX-01       gtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactggggcc
                     ****  ****  *    * **  *   **   * * ***  **  * ************

F6PMP8_BAK1-01      gagtggtggctctcctgggctttggctaccgcctggccct-----gcatgtctaccaa--
Q52HB2_BAK1-01      gagtggtggctctcctgggctttggctaccgcctggccct-----gcatgtctaccaa--
F1PAN9_BAX-01       gggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
F1PAN9_BAX-02       gggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
Q8HYU5_BAX-01       gggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaagg
                    * ** ** ** *** *   ***** *  *   ****  **      * *** ******  

F6PMP8_BAK1-01      --cgcggcctgaccgg---cttcctgggccaggt----gacccgcttcgtggccgacttc
Q52HB2_BAK1-01      --cgcggcctgaccgg---cttcctgggccaggt----gacccgcttcgtggccgacttc
F1PAN9_BAX-01       tgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcggc---
F1PAN9_BAX-02       tgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcggc---
Q8HYU5_BAX-01       tgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcggc---
                      * **  **** * *   * ** *****  *      ***   ***** *  ** *   

F6PMP8_BAK1-01      atgctgcatcattgcattgcccggtggatcgcgcagaggggtggctggg----tggcagc
Q52HB2_BAK1-01      atgctgcatcattgcattgcccggtggatcgcgcagaggggtggctggg----tggcagc
F1PAN9_BAX-01       -tgctg---------------ggctggatccaggaccagggtggttggg-----------
F1PAN9_BAX-02       -tgctg---------------ggctggatccaggaccagggtggttggg-----------
Q8HYU5_BAX-01       -tgctg---------------ggctggatccaggaccagggtggttgggacggcctcctc
                     *****                * ******  * *   ****** ****           

F6PMP8_BAK1-01      cctgaacttgggaaacggccccatcctgaacgtgctgatagtgctgtctgtggttctgtt
Q52HB2_BAK1-01      cctgaacttgggaaacggccccatcctgaacgtgctgatagtgctgtctgtggttctgtt
F1PAN9_BAX-01       --------tgag-------------------gc--------------ctgtaaccccct-
F1PAN9_BAX-02       --------tgag-------------------gc--------------ctgtaaccccc--
Q8HYU5_BAX-01       tcctactttggg-------------------acacccacgtggcagacagtgaccatctt
                            ** *                                   * **         

F6PMP8_BAK1-01      gggccagtttgtgcctacaggtctgggggaaaggagagagaagttcatgattaagccaaa
Q52HB2_BAK1-01      gggccagtttgtg-----------------------------------------------
F1PAN9_BAX-01       ------------------------------------------------------------
F1PAN9_BAX-02       ------------------------------------------------------------
Q8HYU5_BAX-01       tgtggctggagtgcttactgc---------------------------------------

F6PMP8_BAK1-01      tgcagggagcggatgcagatggagcccgctgaccagcccccaccctctgagtgtgtctga
Q52HB2_BAK1-01      ----------gtacgaagat----------------------tcttc-------------
F1PAN9_BAX-01       -------------------------------------------ccccccaactcct----
F1PAN9_BAX-02       ------------------------------------------------------------
Q8HYU5_BAX-01       ------------------------------------------gtcactcaccatctggaa

F6PMP8_BAK1-01      aaataaactgtaa
Q52HB2_BAK1-01      ----aaatcatga
F1PAN9_BAX-01       ---------ctga
F1PAN9_BAX-02       -------------
Q8HYU5_BAX-01       aaagatgggctga

© 1998-2019