Dataset for CDS BAX of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F1PAN9_BAX-01      atgagccaccctagttcgctgggtcc-cctaggacccaagagtccaggcacctcttccct
F1PAN9_BAX-02      atggac--------------gggtccggggagcaacccagaggcggg-------------
Q8HYU5_BAX-01      atggac--------------gggtccggggagcaacccagaggcggg-------------
                   ***  *              ******    ** * ** **** *  *             

F1PAN9_BAX-01      cctttctcctctagggcccaccagctctgagcagatcatgaagacaggggcccttttgct
F1PAN9_BAX-02      -------------gggcccaccagctctgagcagatcatgaagacaggggcccttttgct
Q8HYU5_BAX-01      -------------gggcccaccagctctgagcagatcatgaagacaggggcccttttgct

F1PAN9_BAX-01      tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgccctt
F1PAN9_BAX-02      tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgccctt
Q8HYU5_BAX-01      tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgccctt

F1PAN9_BAX-01      ggagcaggtgccccaggatgcatccaccaagaagctgagcgaatgtctcaagcgcatcgg
F1PAN9_BAX-02      ggagcaggtgccccaggatgcatccaccaagaagctgagcgaatgtctcaagcgcatcgg
Q8HYU5_BAX-01      ggagcaggtgccccaggatgcatccaccaagaagctgagcgaatgtctcaagcgcatcgg

F1PAN9_BAX-01      agatgaactggacagtaacatggagttgcagaggatgatcgcagctgtggacacagactc
F1PAN9_BAX-02      agatgaactggacagtaacatggagttgcagaggatgatcgcagctgtggacacagactc
Q8HYU5_BAX-01      agatgaactggacagtaacatggagttgcagaggatgatcgcagctgtggacacagactc

F1PAN9_BAX-01      tccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
F1PAN9_BAX-02      tccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
Q8HYU5_BAX-01      tccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg

F1PAN9_BAX-01      gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtac
F1PAN9_BAX-02      gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtac
Q8HYU5_BAX-01      gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtac

F1PAN9_BAX-01      caaggtgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcg
F1PAN9_BAX-02      caaggtgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcg
Q8HYU5_BAX-01      caaggtgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcg

F1PAN9_BAX-01      gctgctgggctggatccaggaccagggtggttggg-------------------tgaggc
F1PAN9_BAX-02      gctgctgggctggatccaggaccagggtggttggg-------------------tgaggc
Q8HYU5_BAX-01      gctgctgggctggatccaggaccagggtggttgggacggcctcctctcctactttgggac
                   ***********************************                   ** * *

F1PAN9_BAX-01      --------------ctgtaaccccct-----------------------ccccccaactc
F1PAN9_BAX-02      --------------ctgtaaccccc-----------------------------------
Q8HYU5_BAX-01      acccacgtggcagacagtgaccatctttgtggctggagtgcttactgcgtcactcaccat
                                 * ** ***  *                                   

F1PAN9_BAX-01      ct-------------ctga
F1PAN9_BAX-02      -------------------
Q8HYU5_BAX-01      ctggaaaaagatgggctga

© 1998-2019